Incidental Mutation 'R7263:Rb1'
ID564770
Institutional Source Beutler Lab
Gene Symbol Rb1
Ensembl Gene ENSMUSG00000022105
Gene NameRB transcriptional corepressor 1
SynonymsRb-1, Rb, pRb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7263 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location73183673-73325822 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 73282923 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 215 (C215*)
Ref Sequence ENSEMBL: ENSMUSP00000022701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022701] [ENSMUST00000164624]
Predicted Effect probably null
Transcript: ENSMUST00000022701
AA Change: C215*
SMART Domains Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105
AA Change: C215*

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 37 53 N/A INTRINSIC
DUF3452 97 223 4.59e-25 SMART
RB_A 367 567 5.53e-92 SMART
CYCLIN 653 740 1.62e-5 SMART
Rb_C 761 920 1.28e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164624
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit abnormalities of the neuronal and hematopoietic systems and die in utero. Heterozygotes may develop pituitary tumors associated with loss of the normal allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,054,194 H55N probably damaging Het
Acan G T 7: 79,092,318 V488L probably damaging Het
Adam12 T C 7: 133,919,511 E638G possibly damaging Het
Adamts20 T A 15: 94,322,891 Q1387L possibly damaging Het
Adamts3 G T 5: 89,677,742 D1079E probably benign Het
Barx1 G T 13: 48,665,079 G93C probably damaging Het
Carmil2 C T 8: 105,693,045 R828C probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc159 T C 9: 21,931,711 M148T probably benign Het
Cdk5rap1 T A 2: 154,360,732 N193Y probably benign Het
Csnk1g2 G A 10: 80,634,498 G15D probably damaging Het
Dach1 T C 14: 98,168,859 S151G probably benign Het
Elf5 C A 2: 103,439,300 N75K probably benign Het
Elp3 T C 14: 65,565,333 D272G probably damaging Het
Epb41l1 T A 2: 156,495,123 probably null Het
Epha6 A G 16: 59,775,665 Y888H probably damaging Het
Fibcd1 T C 2: 31,817,210 Y345C probably damaging Het
Gjc1 C T 11: 102,800,137 E347K possibly damaging Het
Gm16486 A G 8: 70,710,776 N873D possibly damaging Het
Gse1 A G 8: 120,574,171 D892G unknown Het
Gtpbp6 A T 5: 110,104,049 I506N probably benign Het
Hivep1 T A 13: 42,158,192 F1303I possibly damaging Het
Il21r A G 7: 125,632,905 T502A probably benign Het
Ints1 T C 5: 139,764,079 T997A possibly damaging Het
Invs C A 4: 48,396,381 N351K probably damaging Het
Iqcm A G 8: 75,763,073 T390A probably benign Het
Kcnh4 C T 11: 100,741,817 G948D probably benign Het
Kcnh7 T A 2: 62,735,970 probably null Het
Lrrc72 A G 12: 36,208,612 V82A probably damaging Het
Macf1 A T 4: 123,378,150 L6535Q probably damaging Het
Ncor2 G C 5: 125,032,132 L585V Het
Nipal2 G C 15: 34,578,758 Y298* probably null Het
Nipsnap1 C T 11: 4,882,960 probably benign Het
Olfr1112 T A 2: 87,192,132 C148* probably null Het
Olfr1267-ps1 T C 2: 90,085,988 I158V not run Het
Olfr578 A T 7: 102,984,317 Y282* probably null Het
Pcdhga4 C T 18: 37,686,820 T474I probably benign Het
Pdp1 G T 4: 11,960,821 Q516K possibly damaging Het
Pik3c2b C T 1: 133,090,202 P934L probably damaging Het
Pp2d1 A G 17: 53,515,330 I236T probably benign Het
Pygm G A 19: 6,388,327 R278H probably damaging Het
Rgs22 A G 15: 36,015,643 S1156P possibly damaging Het
Rgs9bp T C 7: 35,584,701 T174A probably damaging Het
Rnf133 A T 6: 23,649,668 Y130* probably null Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Serpinb6e A T 13: 33,838,940 F153L probably benign Het
Slc22a1 A T 17: 12,666,700 Y200N probably damaging Het
Slc22a22 C A 15: 57,249,711 M377I probably benign Het
Slc36a4 A G 9: 15,722,156 probably null Het
Slc39a6 A G 18: 24,601,203 V143A probably benign Het
Slf2 G A 19: 44,938,424 probably null Het
Sowaha T C 11: 53,479,658 K84E probably benign Het
Spef2 T G 15: 9,653,012 probably null Het
Sphkap A T 1: 83,276,678 F1117I probably damaging Het
Tas2r113 T C 6: 132,893,576 I189T possibly damaging Het
Tescl T C 7: 24,333,822 E26G possibly damaging Het
Trpm6 A T 19: 18,876,786 I1847F probably damaging Het
Uba1y T A Y: 822,200 C178S possibly damaging Het
Ush2a T A 1: 188,443,329 V1208D possibly damaging Het
Usp13 G C 3: 32,894,851 A446P probably damaging Het
Usp7 A T 16: 8,696,724 C722S possibly damaging Het
Vmn1r52 A G 6: 90,179,553 S280G probably benign Het
Vmn2r84 T C 10: 130,389,208 K478E probably damaging Het
Zfp112 C A 7: 24,125,527 L311I probably benign Het
Zfp180 G T 7: 24,105,700 E515* probably null Het
Zfp518b A G 5: 38,672,328 I778T probably damaging Het
Zfp800 A T 6: 28,243,663 H434Q probably benign Het
Other mutations in Rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Rb1 APN 14 73264598 missense probably damaging 1.00
IGL00951:Rb1 APN 14 73322072 missense probably damaging 1.00
IGL01152:Rb1 APN 14 73205870 missense probably damaging 1.00
IGL01339:Rb1 APN 14 73264371 critical splice acceptor site probably null
IGL01349:Rb1 APN 14 73269118 missense probably damaging 1.00
IGL01390:Rb1 APN 14 73294999 missense probably benign 0.02
IGL02066:Rb1 APN 14 73198534 missense probably benign 0.06
IGL02207:Rb1 APN 14 73206085 missense probably damaging 1.00
IGL02860:Rb1 APN 14 73206012 missense probably damaging 1.00
IGL03370:Rb1 APN 14 73282866 critical splice donor site probably null
rubidium UTSW 14 73199311 missense probably damaging 1.00
P0028:Rb1 UTSW 14 73264628 missense probably damaging 1.00
R0553:Rb1 UTSW 14 73211712 nonsense probably null
R0563:Rb1 UTSW 14 73216767 missense probably damaging 1.00
R0586:Rb1 UTSW 14 73287684 intron probably benign
R0595:Rb1 UTSW 14 73273680 missense probably damaging 1.00
R0755:Rb1 UTSW 14 73197213 makesense probably null
R1480:Rb1 UTSW 14 73262602 missense probably benign
R1513:Rb1 UTSW 14 73322084 missense probably benign 0.00
R1752:Rb1 UTSW 14 73287624 missense probably damaging 0.99
R1919:Rb1 UTSW 14 73212990 nonsense probably null
R2010:Rb1 UTSW 14 73294993 missense probably benign 0.16
R2087:Rb1 UTSW 14 73280252 missense probably benign 0.09
R2152:Rb1 UTSW 14 73288725 missense probably benign
R2167:Rb1 UTSW 14 73211651 missense probably damaging 1.00
R3950:Rb1 UTSW 14 73262662 missense probably damaging 1.00
R4183:Rb1 UTSW 14 73198526 splice site probably null
R4225:Rb1 UTSW 14 73269191 missense possibly damaging 0.58
R4306:Rb1 UTSW 14 73262695 missense probably damaging 1.00
R4464:Rb1 UTSW 14 73199198 intron probably null
R4609:Rb1 UTSW 14 73262514 splice site probably benign
R4671:Rb1 UTSW 14 73273676 missense probably damaging 1.00
R4916:Rb1 UTSW 14 73216691 missense probably damaging 1.00
R5160:Rb1 UTSW 14 73264455 synonymous silent
R5210:Rb1 UTSW 14 73199311 missense probably damaging 1.00
R5320:Rb1 UTSW 14 73213126 nonsense probably null
R5436:Rb1 UTSW 14 73213140 splice site probably null
R5467:Rb1 UTSW 14 73211620 missense possibly damaging 0.92
R5592:Rb1 UTSW 14 73211747 missense probably damaging 1.00
R6326:Rb1 UTSW 14 73198534 missense probably benign 0.06
R6363:Rb1 UTSW 14 73287641 missense probably benign 0.01
R6395:Rb1 UTSW 14 73199196 missense probably damaging 1.00
R6414:Rb1 UTSW 14 73282974 missense unknown
R6460:Rb1 UTSW 14 73278454 missense probably benign 0.06
R6503:Rb1 UTSW 14 73205880 missense probably benign 0.08
R6519:Rb1 UTSW 14 73298063 missense probably benign 0.00
R6671:Rb1 UTSW 14 73197266 missense probably damaging 1.00
R7026:Rb1 UTSW 14 73298099 missense probably benign 0.00
R7103:Rb1 UTSW 14 73262644 missense probably damaging 1.00
R7478:Rb1 UTSW 14 73269137 missense probably damaging 1.00
R7519:Rb1 UTSW 14 73264608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCCACACCTGATAATGTTTCATC -3'
(R):5'- AAAAGTCTTTATTGTGGCTGTAGCG -3'

Sequencing Primer
(F):5'- TGTTTCATCATCCTTCAGTTTAAGG -3'
(R):5'- AACCCGAGTTTGTCATGGGAC -3'
Posted On2019-06-26