Incidental Mutation 'R7264:Lhx9'
ID 564787
Institutional Source Beutler Lab
Gene Symbol Lhx9
Ensembl Gene ENSMUSG00000019230
Gene Name LIM homeobox protein 9
Synonyms 3110009O07Rik, Lhx9 alpha, LH2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.696) question?
Stock # R7264 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 138825186-138848577 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 138832751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 296 (D296G)
Ref Sequence ENSEMBL: ENSMUSP00000107657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019374] [ENSMUST00000046870] [ENSMUST00000093486] [ENSMUST00000112026] [ENSMUST00000112030] [ENSMUST00000194557]
AlphaFold Q9WUH2
Predicted Effect probably damaging
Transcript: ENSMUST00000019374
AA Change: D296G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019374
Gene: ENSMUSG00000019230
AA Change: D296G

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 319 1.89e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000046870
AA Change: D287G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036480
Gene: ENSMUSG00000019230
AA Change: D287G

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 320 8.07e-22 SMART
low complexity region 344 368 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093486
AA Change: D287G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091198
Gene: ENSMUSG00000019230
AA Change: D287G

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112026
AA Change: D296G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107657
Gene: ENSMUSG00000019230
AA Change: D296G

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 329 8.07e-22 SMART
low complexity region 353 377 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112030
AA Change: D287G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107661
Gene: ENSMUSG00000019230
AA Change: D287G

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194557
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM homeobox gene family of developmentally expressed transcription factors. The encoded protein contains a homeodomain and two cysteine-rich zinc-binding LIM domains involved in protein-protein interactions. The protein is highly similar to a mouse protein that causes gonadal agenesis when inactivated, suggesting a role in gonadal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failed proliferation of the somatic cells of the genital ridge resulting in lack of discrete gonad formation, infertility in both sexes, and female-like genitalia in genetically male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,334 S200P not run Het
Adora3 C A 3: 105,904,825 T9K probably benign Het
Ankib1 T A 5: 3,755,739 N176I probably damaging Het
Ankle2 G A 5: 110,237,823 G346D probably damaging Het
Anks1b T A 10: 90,512,870 M800K probably benign Het
Arhgef16 C T 4: 154,280,930 G576D probably damaging Het
BC030867 T A 11: 102,255,596 C233S probably benign Het
C2cd2 C A 16: 97,876,219 probably null Het
Cacna1c T C 6: 118,602,195 N1847S Het
Camta1 A G 4: 151,453,399 I108T probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Cep192 A G 18: 67,820,355 Y481C probably damaging Het
Cep250 A G 2: 155,979,151 E887G probably damaging Het
Clcn1 C A 6: 42,298,838 A298D probably damaging Het
Col11a1 A G 3: 114,185,599 N1305S unknown Het
Depdc5 T C 5: 32,967,745 V1155A probably benign Het
Dnah1 A T 14: 31,269,894 D3050E probably benign Het
Dnah7a T C 1: 53,518,814 D2147G probably benign Het
Fbxl4 T C 4: 22,386,145 Y251H possibly damaging Het
Gm19410 A G 8: 35,785,766 M622V probably benign Het
Gm3402 T A 5: 146,514,662 M110K probably damaging Het
Gm4778 C T 3: 94,265,738 H14Y possibly damaging Het
Gm8257 T A 14: 44,656,360 E82D probably damaging Het
Gne T A 4: 44,042,175 I498F probably damaging Het
Gstcd C T 3: 133,084,779 V76I probably benign Het
Hgs G T 11: 120,474,313 V176L probably benign Het
Igbp1b T C 6: 138,658,110 N112S possibly damaging Het
Itga11 A T 9: 62,745,908 T355S probably benign Het
Lama1 A T 17: 67,743,297 H301L Het
Lrp1 C T 10: 127,592,093 G537D probably damaging Het
Mroh2b A G 15: 4,921,362 I581V possibly damaging Het
Mrps36 A G 13: 100,739,199 S36P probably benign Het
Olfr618 T A 7: 103,597,748 I144N probably damaging Het
Plcb4 A T 2: 135,965,080 N547I probably benign Het
Plch2 T A 4: 154,998,967 M505L probably damaging Het
Prg4 T A 1: 150,454,067 N154Y not run Het
Rev1 A T 1: 38,085,601 V420D probably damaging Het
Rin3 A G 12: 102,390,115 I972V probably benign Het
Rtel1 T C 2: 181,351,861 L775P not run Het
Scarf2 G T 16: 17,803,290 C274F possibly damaging Het
Serinc2 C T 4: 130,258,259 V271I probably benign Het
Slpi C A 2: 164,356,402 probably benign Het
Stxbp6 T C 12: 44,901,999 D109G probably damaging Het
Tmem74 G A 15: 43,867,468 L60F probably benign Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Trrap T C 5: 144,814,523 S1610P probably benign Het
Ttc33 C T 15: 5,217,237 Q175* probably null Het
Usp34 A G 11: 23,333,566 T106A probably benign Het
Vmn1r204 A G 13: 22,556,997 D266G probably benign Het
Wdfy3 C A 5: 101,855,523 A2905S probably benign Het
Wfs1 A G 5: 36,967,846 L567P probably damaging Het
Zfp42 T C 8: 43,296,275 E63G probably damaging Het
Zfp957 A G 14: 79,213,640 F240L probably damaging Het
Zgrf1 A T 3: 127,563,569 M815L probably benign Het
Other mutations in Lhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Lhx9 APN 1 138828680 missense possibly damaging 0.74
IGL01624:Lhx9 APN 1 138832783 nonsense probably null
IGL02149:Lhx9 APN 1 138831434 missense probably damaging 1.00
IGL02452:Lhx9 APN 1 138841842 missense probably damaging 1.00
IGL02982:Lhx9 APN 1 138838611 missense probably damaging 1.00
R0123:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0134:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0141:Lhx9 UTSW 1 138840006 missense possibly damaging 0.86
R0225:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0281:Lhx9 UTSW 1 138832904 missense probably benign 0.00
R1460:Lhx9 UTSW 1 138838709 splice site probably benign
R1932:Lhx9 UTSW 1 138842009 start gained probably benign
R4738:Lhx9 UTSW 1 138832748 missense probably damaging 1.00
R4792:Lhx9 UTSW 1 138838351 missense possibly damaging 0.87
R4820:Lhx9 UTSW 1 138838367 missense probably benign 0.00
R4877:Lhx9 UTSW 1 138838354 missense probably benign 0.04
R6035:Lhx9 UTSW 1 138838543 missense possibly damaging 0.67
R6035:Lhx9 UTSW 1 138838543 missense possibly damaging 0.67
R6825:Lhx9 UTSW 1 138841806 frame shift probably null
R6852:Lhx9 UTSW 1 138841806 frame shift probably null
R6853:Lhx9 UTSW 1 138841806 frame shift probably null
R8097:Lhx9 UTSW 1 138838351 missense probably damaging 0.97
R8164:Lhx9 UTSW 1 138832780 missense probably damaging 1.00
R8245:Lhx9 UTSW 1 138838441 missense probably benign 0.24
R8278:Lhx9 UTSW 1 138838586 missense probably damaging 0.98
R8951:Lhx9 UTSW 1 138841966 missense probably damaging 1.00
Z1177:Lhx9 UTSW 1 138831498 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCATCTGTAGGGAGAATGTG -3'
(R):5'- TCACTCTTTGCTGCAACAGG -3'

Sequencing Primer
(F):5'- GAGAATGTGAATCCTGGATGTCTATC -3'
(R):5'- TTGCTGCAACAGGTTGTAATGAGAAC -3'
Posted On 2019-06-26