Incidental Mutation 'R0582:Snap47'
ID 56479
Institutional Source Beutler Lab
Gene Symbol Snap47
Ensembl Gene ENSMUSG00000009894
Gene Name synaptosomal-associated protein, 47
Synonyms SNAP-47, 1110031B06Rik
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0582 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 59407134-59451186 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 59428433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 293 (L293*)
Ref Sequence ENSEMBL: ENSMUSP00000113555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010038] [ENSMUST00000120940] [ENSMUST00000136436] [ENSMUST00000156146]
AlphaFold Q8R570
Predicted Effect probably null
Transcript: ENSMUST00000010038
AA Change: L293*
SMART Domains Protein: ENSMUSP00000010038
Gene: ENSMUSG00000009894
AA Change: L293*

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
low complexity region 335 349 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120940
AA Change: L293*
SMART Domains Protein: ENSMUSP00000113555
Gene: ENSMUSG00000009894
AA Change: L293*

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136436
SMART Domains Protein: ENSMUSP00000115762
Gene: ENSMUSG00000009894

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156146
SMART Domains Protein: ENSMUSP00000121880
Gene: ENSMUSG00000009894

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Snap47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Snap47 APN 11 59421651 critical splice acceptor site probably null
IGL02113:Snap47 APN 11 59428436 missense probably damaging 0.99
IGL03290:Snap47 APN 11 59428598 missense probably damaging 1.00
R0126:Snap47 UTSW 11 59437987 missense probably damaging 0.99
R0633:Snap47 UTSW 11 59428613 missense probably benign 0.25
R0883:Snap47 UTSW 11 59438500 utr 5 prime probably benign
R1657:Snap47 UTSW 11 59428770 missense probably benign 0.08
R1855:Snap47 UTSW 11 59428333 unclassified probably benign
R2761:Snap47 UTSW 11 59438059 missense probably benign 0.01
R4079:Snap47 UTSW 11 59428551 missense probably benign 0.38
R4805:Snap47 UTSW 11 59428517 missense possibly damaging 0.91
R4960:Snap47 UTSW 11 59428543 missense probably damaging 1.00
R5212:Snap47 UTSW 11 59428352 missense probably damaging 0.99
R5793:Snap47 UTSW 11 59438192 missense probably damaging 1.00
R7243:Snap47 UTSW 11 59428722 missense probably benign 0.04
R7603:Snap47 UTSW 11 59428547 missense probably damaging 1.00
R7870:Snap47 UTSW 11 59438078 missense probably benign 0.11
R8001:Snap47 UTSW 11 59438354 missense probably benign 0.20
R9156:Snap47 UTSW 11 59428464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTGTAAGTTGGCAGTCTGGAAG -3'
(R):5'- TCATTCCAAGCTGGGAAAGCTCAC -3'

Sequencing Primer
(F):5'- GTTCCAGCCTGTGACTGC -3'
(R):5'- GAAAGCTCACTGTCCTGGTC -3'
Posted On 2013-07-11