Mutagenetix > Incidental Mutation

Incidental Mutation 'R0582:Zfyve26'

56480

Institutional Source

Beutler Lab

Gene Symbol

Zfyve26

Ensembl Gene

ENSMUSG00000066440

Gene Name

zinc finger, FYVE domain containing 26

Synonyms

A630028O16Rik, LOC380767, 9330197E15Rik

MMRRC Submission

038772-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0582 (G1)

Quality Score

195

Status

Validated

Chromosome

Chromosomal Location

79232346-79296304 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79246222 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2051 (D2051G)

Ref Sequence

ENSEMBL: ENSMUSP00000021547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377]

AlphaFold

Q5DU37

Predicted Effect

probably damaging
Transcript: ENSMUST00000021547
AA Change: D2051G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: D2051G

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	752	775	N/A	INTRINSIC
low complexity region	778	796	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
low complexity region	1073	1091	N/A	INTRINSIC
low complexity region	1104	1115	N/A	INTRINSIC
low complexity region	1151	1163	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
low complexity region	1228	1241	N/A	INTRINSIC
low complexity region	1565	1584	N/A	INTRINSIC
low complexity region	1743	1770	N/A	INTRINSIC
FYVE	1794	1863	1.49e-27	SMART
low complexity region	2486	2498	N/A	INTRINSIC
low complexity region	2517	2528	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218377

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220092

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220390

Meta Mutation Damage Score

0.5630

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.6%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	G	A	10: 3,125,082		noncoding transcript	Het
Abcb5	A	T	12: 118,940,412	M186K	probably benign	Het
Afm	T	C	5: 90,524,780		probably benign	Het
Arfgef3	G	A	10: 18,611,290	A1332V	probably damaging	Het
Atp11a	T	C	8: 12,831,214	S451P	probably benign	Het
Birc6	T	A	17: 74,643,337	V3189E	probably damaging	Het
Ccdc150	C	T	1: 54,329,511	A626V	probably benign	Het
Ccdc50	G	A	16: 27,444,659		probably benign	Het
Cntln	T	C	4: 84,884,741	S93P	probably damaging	Het
Ctnna2	C	A	6: 77,758,417	V106L	probably benign	Het
Ctnnal1	G	C	4: 56,813,228	Q668E	probably damaging	Het
Cyp1a2	G	A	9: 57,680,246		probably benign	Het
Dnah8	A	G	17: 30,718,961	D1604G	probably benign	Het
Dscaml1	A	T	9: 45,668,264	I370F	possibly damaging	Het
Ears2	T	C	7: 122,055,658	E129G	probably benign	Het
Gm4981	A	T	10: 58,235,686	S235R	probably benign	Het
Igsf10	T	C	3: 59,319,767	I2162V	probably benign	Het
Ints9	C	T	14: 64,980,149	P42S	probably damaging	Het
Ipp	T	C	4: 116,515,467	L231S	probably damaging	Het
Lyn	T	A	4: 3,743,296	L72Q	probably damaging	Het
Nfe2l2	T	A	2: 75,676,768	E329D	probably damaging	Het
Olfr628	G	A	7: 103,732,673	C249Y	possibly damaging	Het
Olfr92	G	C	17: 37,111,455	L176V	probably benign	Het
Pdyn	A	C	2: 129,689,738	L44R	probably damaging	Het
Pkd1l1	A	G	11: 8,931,699		probably benign	Het
Prpf40a	A	T	2: 53,145,692	F695L	probably damaging	Het
Rnf217	A	G	10: 31,608,767	Y140H	possibly damaging	Het
Sema6c	C	T	3: 95,169,197	R265C	probably damaging	Het
Slc7a8	C	A	14: 54,758,444	C167F	probably damaging	Het
Snap47	A	T	11: 59,428,433	L293*	probably null	Het
Snx3	A	T	10: 42,533,280		probably benign	Het
Sycp2l	T	A	13: 41,137,955		probably benign	Het
Taar3	A	G	10: 23,949,817	Y87C	probably damaging	Het
Tm4sf4	T	C	3: 57,433,857		probably benign	Het
Tssc4	T	C	7: 143,070,509	S185P	probably damaging	Het
Ttc28	G	T	5: 111,183,296	A430S	probably damaging	Het
Vmn2r27	T	C	6: 124,224,290	D236G	probably benign	Het
Vps54	G	T	11: 21,300,137	D508Y	probably damaging	Het
Wdr53	G	A	16: 32,251,908	V24M	probably damaging	Het
Xirp2	T	G	2: 67,508,866	L484V	probably benign	Het

Other mutations in Zfyve26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Zfyve26	APN	12	79249460	unclassified	probably benign
IGL00940:Zfyve26	APN	12	79280900	missense	probably benign
IGL01148:Zfyve26	APN	12	79260870	missense	probably benign	0.01
IGL01347:Zfyve26	APN	12	79252183	splice site	probably null
IGL01472:Zfyve26	APN	12	79276343	missense	probably benign	0.01
IGL01490:Zfyve26	APN	12	79244373	missense	probably damaging	1.00
IGL01516:Zfyve26	APN	12	79287851	missense	probably benign	0.37
IGL01642:Zfyve26	APN	12	79261574	splice site	probably null
IGL01689:Zfyve26	APN	12	79284053	missense	possibly damaging	0.71
IGL01877:Zfyve26	APN	12	79287444	missense	probably damaging	1.00
IGL01997:Zfyve26	APN	12	79244400	missense	probably benign	0.00
IGL02077:Zfyve26	APN	12	79276395	missense	possibly damaging	0.54
IGL02437:Zfyve26	APN	12	79268847	missense	probably benign	0.01
IGL02933:Zfyve26	APN	12	79280080	missense	possibly damaging	0.94
IGL02937:Zfyve26	APN	12	79239020	missense	probably benign	0.08
IGL02982:Zfyve26	APN	12	79263870	missense	probably damaging	0.99
IGL03064:Zfyve26	APN	12	79261791	missense	probably damaging	1.00
IGL03086:Zfyve26	APN	12	79295564	missense	probably damaging	0.96
IGL03146:Zfyve26	APN	12	79284072	nonsense	probably null
challenge	UTSW	12	79270836	critical splice donor site	probably null
fourteener	UTSW	12	79255263	missense	probably damaging	1.00
IGL02799:Zfyve26	UTSW	12	79273310	missense	probably benign	0.28
R0318:Zfyve26	UTSW	12	79276281	missense	probably damaging	1.00
R0513:Zfyve26	UTSW	12	79244484	missense	probably damaging	1.00
R0586:Zfyve26	UTSW	12	79268728	missense	possibly damaging	0.96
R0718:Zfyve26	UTSW	12	79265802	splice site	probably benign
R0738:Zfyve26	UTSW	12	79295534	missense	probably damaging	1.00
R0781:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R0894:Zfyve26	UTSW	12	79273598	missense	possibly damaging	0.80
R1109:Zfyve26	UTSW	12	79272127	missense	probably damaging	1.00
R1110:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R1186:Zfyve26	UTSW	12	79263949	missense	probably damaging	1.00
R1295:Zfyve26	UTSW	12	79274920	missense	probably damaging	1.00
R1430:Zfyve26	UTSW	12	79282817	missense	probably benign	0.07
R1439:Zfyve26	UTSW	12	79252163	missense	probably benign	0.03
R1517:Zfyve26	UTSW	12	79252151	missense	probably damaging	0.98
R1553:Zfyve26	UTSW	12	79287761	missense	probably benign	0.00
R1721:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1758:Zfyve26	UTSW	12	79238944	missense	probably damaging	1.00
R1779:Zfyve26	UTSW	12	79278463	missense	probably damaging	1.00
R1785:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1786:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1826:Zfyve26	UTSW	12	79269049	missense	probably damaging	1.00
R1833:Zfyve26	UTSW	12	79286258	missense	probably benign	0.36
R1868:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1900:Zfyve26	UTSW	12	79264351	missense	probably damaging	1.00
R1928:Zfyve26	UTSW	12	79239970	nonsense	probably null
R1982:Zfyve26	UTSW	12	79255243	missense	possibly damaging	0.55
R2062:Zfyve26	UTSW	12	79284032	splice site	probably null
R2071:Zfyve26	UTSW	12	79287446	missense	possibly damaging	0.95
R2130:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2132:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2133:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2135:Zfyve26	UTSW	12	79246052	missense	possibly damaging	0.80
R2207:Zfyve26	UTSW	12	79246087	missense	probably damaging	0.99
R2280:Zfyve26	UTSW	12	79275040	missense	probably damaging	1.00
R2352:Zfyve26	UTSW	12	79284116	missense	probably damaging	1.00
R2398:Zfyve26	UTSW	12	79282799	splice site	probably null
R3084:Zfyve26	UTSW	12	79265683	splice site	probably benign
R3086:Zfyve26	UTSW	12	79265683	splice site	probably benign
R4626:Zfyve26	UTSW	12	79269070	missense	possibly damaging	0.95
R4727:Zfyve26	UTSW	12	79244396	missense	probably benign	0.16
R4908:Zfyve26	UTSW	12	79249695	splice site	probably null
R4926:Zfyve26	UTSW	12	79275011	missense	probably benign
R4990:Zfyve26	UTSW	12	79287833	missense	probably damaging	1.00
R4999:Zfyve26	UTSW	12	79280385	nonsense	probably null
R5029:Zfyve26	UTSW	12	79286323	missense	probably damaging	0.99
R5070:Zfyve26	UTSW	12	79255361	missense	probably damaging	1.00
R5100:Zfyve26	UTSW	12	79280058	nonsense	probably null
R5252:Zfyve26	UTSW	12	79268982	missense	probably damaging	1.00
R5318:Zfyve26	UTSW	12	79270850	missense	probably benign	0.35
R5509:Zfyve26	UTSW	12	79246521	missense	probably damaging	1.00
R5574:Zfyve26	UTSW	12	79239924	missense	possibly damaging	0.63
R5735:Zfyve26	UTSW	12	79273373	missense	probably damaging	0.96
R5756:Zfyve26	UTSW	12	79264357	missense	probably damaging	1.00
R5773:Zfyve26	UTSW	12	79287737	missense	probably damaging	1.00
R5834:Zfyve26	UTSW	12	79266537	missense	probably benign	0.30
R6075:Zfyve26	UTSW	12	79293854	missense	possibly damaging	0.74
R6184:Zfyve26	UTSW	12	79268727	missense	probably damaging	0.98
R6235:Zfyve26	UTSW	12	79249599	missense	probably damaging	1.00
R6247:Zfyve26	UTSW	12	79282984	missense	probably benign	0.04
R6320:Zfyve26	UTSW	12	79240002	missense	probably damaging	0.97
R6548:Zfyve26	UTSW	12	79238335	missense	probably damaging	1.00
R6887:Zfyve26	UTSW	12	79266449	missense	probably damaging	1.00
R7133:Zfyve26	UTSW	12	79284152	missense	probably benign	0.06
R7152:Zfyve26	UTSW	12	79279114	missense	probably benign	0.42
R7165:Zfyve26	UTSW	12	79280405	missense	probably damaging	1.00
R7181:Zfyve26	UTSW	12	79268408	missense	probably benign	0.00
R7223:Zfyve26	UTSW	12	79246171	missense	probably damaging	0.99
R7296:Zfyve26	UTSW	12	79278372	splice site	probably null
R7299:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7301:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7302:Zfyve26	UTSW	12	79251168	missense	probably damaging	1.00
R7355:Zfyve26	UTSW	12	79240054	missense	probably damaging	1.00
R7466:Zfyve26	UTSW	12	79287807	missense	probably benign	0.00
R7540:Zfyve26	UTSW	12	79268676	missense	probably damaging	0.99
R7552:Zfyve26	UTSW	12	79290957	missense	probably damaging	0.97
R7762:Zfyve26	UTSW	12	79268635	missense	probably benign	0.02
R7806:Zfyve26	UTSW	12	79280355	critical splice donor site	probably null
R7821:Zfyve26	UTSW	12	79255324	missense	probably damaging	1.00
R8141:Zfyve26	UTSW	12	79268557	missense	possibly damaging	0.79
R8190:Zfyve26	UTSW	12	79280836	missense	probably benign	0.00
R8207:Zfyve26	UTSW	12	79260831	missense	probably damaging	1.00
R8210:Zfyve26	UTSW	12	79255263	missense	probably damaging	1.00
R8500:Zfyve26	UTSW	12	79287680	missense	probably damaging	0.99
R8686:Zfyve26	UTSW	12	79287453	missense	probably benign
R8758:Zfyve26	UTSW	12	79264309	critical splice donor site	probably benign
R8826:Zfyve26	UTSW	12	79238968	missense	probably benign	0.05
R8877:Zfyve26	UTSW	12	79287378	missense	probably benign	0.05
R9067:Zfyve26	UTSW	12	79272141	missense	probably damaging	0.99
R9195:Zfyve26	UTSW	12	79264394	missense	probably benign	0.12
R9269:Zfyve26	UTSW	12	79276302	missense	possibly damaging	0.73
R9273:Zfyve26	UTSW	12	79270836	critical splice donor site	probably null
R9340:Zfyve26	UTSW	12	79274906	nonsense	probably null
R9348:Zfyve26	UTSW	12	79268457	missense	possibly damaging	0.81
R9482:Zfyve26	UTSW	12	79244465	missense	probably damaging	1.00
R9536:Zfyve26	UTSW	12	79251272	missense	probably benign	0.32
R9653:Zfyve26	UTSW	12	79287644	missense	probably benign
R9676:Zfyve26	UTSW	12	79284185	missense	probably benign	0.01
R9797:Zfyve26	UTSW	12	79246232	missense	probably damaging	0.98
RF010:Zfyve26	UTSW	12	79255338	missense	probably damaging	1.00
X0020:Zfyve26	UTSW	12	79239005	missense	probably damaging	1.00
Z1176:Zfyve26	UTSW	12	79268533	missense	probably benign	0.07
Z1177:Zfyve26	UTSW	12	79287375	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGACATCAGGTGAGGAACCTCTCAG -3'
(R):5'- ATGGACACGTACAGGGCACAAC -3'

Sequencing Primer
(F):5'- GCTTTGCTCTTACCAAGGAAACG -3'
(R):5'- ACAACAGCTTGCCAGGG -3'

Posted On

2013-07-11