Incidental Mutation 'R7264:Camta1'
ID564802
Institutional Source Beutler Lab
Gene Symbol Camta1
Ensembl Gene ENSMUSG00000014592
Gene Namecalmodulin binding transcription activator 1
Synonyms1810059M14Rik, 2310058O09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R7264 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location150917322-151861876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151453399 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 108 (I108T)
Ref Sequence ENSEMBL: ENSMUSP00000054804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049790] [ENSMUST00000097774] [ENSMUST00000169423]
Predicted Effect probably damaging
Transcript: ENSMUST00000049790
AA Change: I108T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054804
Gene: ENSMUSG00000014592
AA Change: I108T

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3e-13 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097774
AA Change: I108T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095381
Gene: ENSMUSG00000014592
AA Change: I108T

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1570 5.45e1 SMART
IQ 1571 1593 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169423
AA Change: I108T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592
AA Change: I108T

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Global or nervous system deletion of this gene results in decreased body size, severe ataxia, progressive Purkinje cell degeneration, and cerebellar atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,334 S200P not run Het
Adora3 C A 3: 105,904,825 T9K probably benign Het
Ankib1 T A 5: 3,755,739 N176I probably damaging Het
Ankle2 G A 5: 110,237,823 G346D probably damaging Het
Anks1b T A 10: 90,512,870 M800K probably benign Het
Arhgef16 C T 4: 154,280,930 G576D probably damaging Het
BC030867 T A 11: 102,255,596 C233S probably benign Het
C2cd2 C A 16: 97,876,219 probably null Het
Cacna1c T C 6: 118,602,195 N1847S Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Cep192 A G 18: 67,820,355 Y481C probably damaging Het
Cep250 A G 2: 155,979,151 E887G probably damaging Het
Clcn1 C A 6: 42,298,838 A298D probably damaging Het
Col11a1 A G 3: 114,185,599 N1305S unknown Het
Depdc5 T C 5: 32,967,745 V1155A probably benign Het
Dnah1 A T 14: 31,269,894 D3050E probably benign Het
Dnah7a T C 1: 53,518,814 D2147G probably benign Het
Fbxl4 T C 4: 22,386,145 Y251H possibly damaging Het
Gm19410 A G 8: 35,785,766 M622V probably benign Het
Gm3402 T A 5: 146,514,662 M110K probably damaging Het
Gm4778 C T 3: 94,265,738 H14Y possibly damaging Het
Gm8257 T A 14: 44,656,360 E82D probably damaging Het
Gne T A 4: 44,042,175 I498F probably damaging Het
Gstcd C T 3: 133,084,779 V76I probably benign Het
Hgs G T 11: 120,474,313 V176L probably benign Het
Igbp1b T C 6: 138,658,110 N112S possibly damaging Het
Itga11 A T 9: 62,745,908 T355S probably benign Het
Lama1 A T 17: 67,743,297 H301L Het
Lhx9 T C 1: 138,832,751 D296G probably damaging Het
Lrp1 C T 10: 127,592,093 G537D probably damaging Het
Mroh2b A G 15: 4,921,362 I581V possibly damaging Het
Mrps36 A G 13: 100,739,199 S36P probably benign Het
Olfr618 T A 7: 103,597,748 I144N probably damaging Het
Plcb4 A T 2: 135,965,080 N547I probably benign Het
Plch2 T A 4: 154,998,967 M505L probably damaging Het
Prg4 T A 1: 150,454,067 N154Y not run Het
Rev1 A T 1: 38,085,601 V420D probably damaging Het
Rin3 A G 12: 102,390,115 I972V probably benign Het
Rtel1 T C 2: 181,351,861 L775P not run Het
Scarf2 G T 16: 17,803,290 C274F possibly damaging Het
Serinc2 C T 4: 130,258,259 V271I probably benign Het
Slpi C A 2: 164,356,402 probably benign Het
Stxbp6 T C 12: 44,901,999 D109G probably damaging Het
Tmem74 G A 15: 43,867,468 L60F probably benign Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Trrap T C 5: 144,814,523 S1610P probably benign Het
Ttc33 C T 15: 5,217,237 Q175* probably null Het
Usp34 A G 11: 23,333,566 T106A probably benign Het
Vmn1r204 A G 13: 22,556,997 D266G probably benign Het
Wdfy3 C A 5: 101,855,523 A2905S probably benign Het
Wfs1 A G 5: 36,967,846 L567P probably damaging Het
Zfp42 T C 8: 43,296,275 E63G probably damaging Het
Zfp957 A G 14: 79,213,640 F240L probably damaging Het
Zgrf1 A T 3: 127,563,569 M815L probably benign Het
Other mutations in Camta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Camta1 APN 4 151071424 critical splice donor site probably null
IGL00823:Camta1 APN 4 151084601 missense probably benign 0.02
IGL01361:Camta1 APN 4 151144692 missense probably damaging 1.00
IGL01523:Camta1 APN 4 151145050 missense possibly damaging 0.73
IGL01730:Camta1 APN 4 151062845 missense probably damaging 0.99
IGL02045:Camta1 APN 4 151073985 splice site probably null
IGL02541:Camta1 APN 4 151084655 missense probably benign 0.12
IGL02839:Camta1 APN 4 151144512 missense probably damaging 1.00
IGL03012:Camta1 APN 4 151453299 missense probably damaging 1.00
PIT4449001:Camta1 UTSW 4 151131586 missense probably benign 0.00
R0136:Camta1 UTSW 4 151078969 missense probably damaging 0.99
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0276:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0346:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0347:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0348:Camta1 UTSW 4 151586431 missense possibly damaging 0.64
R0385:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0386:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0388:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0410:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0456:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0478:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0510:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0511:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0683:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0724:Camta1 UTSW 4 151077892 missense probably damaging 1.00
R0732:Camta1 UTSW 4 151586484 critical splice acceptor site probably null
R1549:Camta1 UTSW 4 151586463 missense probably damaging 1.00
R1670:Camta1 UTSW 4 151079771 missense probably benign 0.00
R1704:Camta1 UTSW 4 151075224 missense probably damaging 1.00
R1718:Camta1 UTSW 4 151084024 missense probably benign 0.00
R1941:Camta1 UTSW 4 151075155 missense probably damaging 1.00
R1967:Camta1 UTSW 4 151088973 missense probably damaging 0.99
R1998:Camta1 UTSW 4 151077880 missense probably damaging 1.00
R2081:Camta1 UTSW 4 151144242 missense probably benign 0.24
R2104:Camta1 UTSW 4 151453294 missense probably damaging 0.99
R2240:Camta1 UTSW 4 151084575 missense possibly damaging 0.66
R4516:Camta1 UTSW 4 151144720 missense possibly damaging 0.90
R4539:Camta1 UTSW 4 151084812 missense probably benign 0.03
R4552:Camta1 UTSW 4 151792502 missense probably damaging 0.96
R4610:Camta1 UTSW 4 151084827 missense probably damaging 1.00
R4658:Camta1 UTSW 4 151143910 missense probably damaging 1.00
R4725:Camta1 UTSW 4 151148496 missense probably benign 0.11
R4786:Camta1 UTSW 4 151290039 missense probably damaging 1.00
R4812:Camta1 UTSW 4 151131542 missense probably null 0.25
R4840:Camta1 UTSW 4 151144407 missense probably benign 0.23
R5038:Camta1 UTSW 4 151145469 missense probably damaging 1.00
R5112:Camta1 UTSW 4 151074054 missense probably damaging 1.00
R5251:Camta1 UTSW 4 151163884 missense probably damaging 1.00
R5388:Camta1 UTSW 4 151075238 missense probably damaging 1.00
R5487:Camta1 UTSW 4 151144754 missense possibly damaging 0.73
R6343:Camta1 UTSW 4 151079849 missense probably damaging 0.98
R6462:Camta1 UTSW 4 151086164 missense probably damaging 0.98
R6550:Camta1 UTSW 4 151138375 missense probably damaging 1.00
R6990:Camta1 UTSW 4 151145044 missense probably damaging 0.97
R7165:Camta1 UTSW 4 151084700 missense possibly damaging 0.63
R7190:Camta1 UTSW 4 151148523 missense possibly damaging 0.57
R7215:Camta1 UTSW 4 151144737 missense probably damaging 1.00
R7403:Camta1 UTSW 4 151453295 nonsense probably null
R7445:Camta1 UTSW 4 151144291 missense possibly damaging 0.94
R7447:Camta1 UTSW 4 151083870 missense probably benign 0.31
X0063:Camta1 UTSW 4 151145247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCATCAGGTCATTTGCAAG -3'
(R):5'- TGCCATAAAACACGGTTAATCC -3'

Sequencing Primer
(F):5'- GCATCAGGTCATTTGCAAGAGATTCC -3'
(R):5'- TTACTGGTCTGTGGTATCC -3'
Posted On2019-06-26