Incidental Mutation 'R7264:Itga11'
ID564818
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7264 (G1)
Quality Score179.009
Status Not validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62745908 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 355 (T355S)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect probably benign
Transcript: ENSMUST00000034774
AA Change: T355S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: T355S

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,334 S200P not run Het
Adora3 C A 3: 105,904,825 T9K probably benign Het
Ankib1 T A 5: 3,755,739 N176I probably damaging Het
Ankle2 G A 5: 110,237,823 G346D probably damaging Het
Anks1b T A 10: 90,512,870 M800K probably benign Het
Arhgef16 C T 4: 154,280,930 G576D probably damaging Het
BC030867 T A 11: 102,255,596 C233S probably benign Het
C2cd2 C A 16: 97,876,219 probably null Het
Cacna1c T C 6: 118,602,195 N1847S Het
Camta1 A G 4: 151,453,399 I108T probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Cep192 A G 18: 67,820,355 Y481C probably damaging Het
Cep250 A G 2: 155,979,151 E887G probably damaging Het
Clcn1 C A 6: 42,298,838 A298D probably damaging Het
Col11a1 A G 3: 114,185,599 N1305S unknown Het
Depdc5 T C 5: 32,967,745 V1155A probably benign Het
Dnah1 A T 14: 31,269,894 D3050E probably benign Het
Dnah7a T C 1: 53,518,814 D2147G probably benign Het
Fbxl4 T C 4: 22,386,145 Y251H possibly damaging Het
Gm19410 A G 8: 35,785,766 M622V probably benign Het
Gm3402 T A 5: 146,514,662 M110K probably damaging Het
Gm4778 C T 3: 94,265,738 H14Y possibly damaging Het
Gm8257 T A 14: 44,656,360 E82D probably damaging Het
Gne T A 4: 44,042,175 I498F probably damaging Het
Gstcd C T 3: 133,084,779 V76I probably benign Het
Hgs G T 11: 120,474,313 V176L probably benign Het
Igbp1b T C 6: 138,658,110 N112S possibly damaging Het
Lama1 A T 17: 67,743,297 H301L Het
Lhx9 T C 1: 138,832,751 D296G probably damaging Het
Lrp1 C T 10: 127,592,093 G537D probably damaging Het
Mroh2b A G 15: 4,921,362 I581V possibly damaging Het
Mrps36 A G 13: 100,739,199 S36P probably benign Het
Olfr618 T A 7: 103,597,748 I144N probably damaging Het
Plcb4 A T 2: 135,965,080 N547I probably benign Het
Plch2 T A 4: 154,998,967 M505L probably damaging Het
Prg4 T A 1: 150,454,067 N154Y not run Het
Rev1 A T 1: 38,085,601 V420D probably damaging Het
Rin3 A G 12: 102,390,115 I972V probably benign Het
Rtel1 T C 2: 181,351,861 L775P not run Het
Scarf2 G T 16: 17,803,290 C274F possibly damaging Het
Serinc2 C T 4: 130,258,259 V271I probably benign Het
Slpi C A 2: 164,356,402 probably benign Het
Stxbp6 T C 12: 44,901,999 D109G probably damaging Het
Tmem74 G A 15: 43,867,468 L60F probably benign Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Trrap T C 5: 144,814,523 S1610P probably benign Het
Ttc33 C T 15: 5,217,237 Q175* probably null Het
Usp34 A G 11: 23,333,566 T106A probably benign Het
Vmn1r204 A G 13: 22,556,997 D266G probably benign Het
Wdfy3 C A 5: 101,855,523 A2905S probably benign Het
Wfs1 A G 5: 36,967,846 L567P probably damaging Het
Zfp42 T C 8: 43,296,275 E63G probably damaging Het
Zfp957 A G 14: 79,213,640 F240L probably damaging Het
Zgrf1 A T 3: 127,563,569 M815L probably benign Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7509:Itga11 UTSW 9 62781940 missense probably benign
R7601:Itga11 UTSW 9 62696926 missense probably benign 0.18
R7615:Itga11 UTSW 9 62744018 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGGTGATAAGCCTTAGGTACCAG -3'
(R):5'- TTCTAGGAGGCAAAGAGACACC -3'

Sequencing Primer
(F):5'- TGATAAGCCTTAGGTACCAGCAACC -3'
(R):5'- GGTAGGAGGACAGCTAGACC -3'
Posted On2019-06-26