Mutagenetix > Incidental Mutations

Incidental Mutation 'R7264:Itga11'

564818

Institutional Source

Beutler Lab

Gene Symbol

Itga11

Ensembl Gene

ENSMUSG00000032243

Gene Name

integrin alpha 11

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R7264 (G1)

Quality Score

179.009

Status

Not validated

Chromosome

Chromosomal Location

62677826-62783982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62745908 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 355 (T355S)

Ref Sequence

ENSEMBL: ENSMUSP00000034774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034774]

Predicted Effect

probably benign
Transcript: ENSMUST00000034774
AA Change: T355S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: T355S

Domain	Start	End	E-Value	Type
Int_alpha	37	90	3.9e-7	SMART
VWA	162	350	2.74e-38	SMART
Int_alpha	421	472	2.19e-1	SMART
Int_alpha	476	532	3.75e-9	SMART
Int_alpha	538	593	1.39e-12	SMART
Int_alpha	600	654	1.08e0	SMART
transmembrane domain	1142	1164	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	A	G	17: 23,712,334	S200P	not run	Het
Adora3	C	A	3: 105,904,825	T9K	probably benign	Het
Ankib1	T	A	5: 3,755,739	N176I	probably damaging	Het
Ankle2	G	A	5: 110,237,823	G346D	probably damaging	Het
Anks1b	T	A	10: 90,512,870	M800K	probably benign	Het
Arhgef16	C	T	4: 154,280,930	G576D	probably damaging	Het
BC030867	T	A	11: 102,255,596	C233S	probably benign	Het
C2cd2	C	A	16: 97,876,219		probably null	Het
Cacna1c	T	C	6: 118,602,195	N1847S		Het
Camta1	A	G	4: 151,453,399	I108T	probably damaging	Het
Catsper4	TTCTC	TTC	4: 134,227,112		probably null	Het
Cep192	A	G	18: 67,820,355	Y481C	probably damaging	Het
Cep250	A	G	2: 155,979,151	E887G	probably damaging	Het
Clcn1	C	A	6: 42,298,838	A298D	probably damaging	Het
Col11a1	A	G	3: 114,185,599	N1305S	unknown	Het
Depdc5	T	C	5: 32,967,745	V1155A	probably benign	Het
Dnah1	A	T	14: 31,269,894	D3050E	probably benign	Het
Dnah7a	T	C	1: 53,518,814	D2147G	probably benign	Het
Fbxl4	T	C	4: 22,386,145	Y251H	possibly damaging	Het
Gm19410	A	G	8: 35,785,766	M622V	probably benign	Het
Gm3402	T	A	5: 146,514,662	M110K	probably damaging	Het
Gm4778	C	T	3: 94,265,738	H14Y	possibly damaging	Het
Gm8257	T	A	14: 44,656,360	E82D	probably damaging	Het
Gne	T	A	4: 44,042,175	I498F	probably damaging	Het
Gstcd	C	T	3: 133,084,779	V76I	probably benign	Het
Hgs	G	T	11: 120,474,313	V176L	probably benign	Het
Igbp1b	T	C	6: 138,658,110	N112S	possibly damaging	Het
Lama1	A	T	17: 67,743,297	H301L		Het
Lhx9	T	C	1: 138,832,751	D296G	probably damaging	Het
Lrp1	C	T	10: 127,592,093	G537D	probably damaging	Het
Mroh2b	A	G	15: 4,921,362	I581V	possibly damaging	Het
Mrps36	A	G	13: 100,739,199	S36P	probably benign	Het
Olfr618	T	A	7: 103,597,748	I144N	probably damaging	Het
Plcb4	A	T	2: 135,965,080	N547I	probably benign	Het
Plch2	T	A	4: 154,998,967	M505L	probably damaging	Het
Prg4	T	A	1: 150,454,067	N154Y	not run	Het
Rev1	A	T	1: 38,085,601	V420D	probably damaging	Het
Rin3	A	G	12: 102,390,115	I972V	probably benign	Het
Rtel1	T	C	2: 181,351,861	L775P	not run	Het
Scarf2	G	T	16: 17,803,290	C274F	possibly damaging	Het
Serinc2	C	T	4: 130,258,259	V271I	probably benign	Het
Slpi	C	A	2: 164,356,402		probably benign	Het
Stxbp6	T	C	12: 44,901,999	D109G	probably damaging	Het
Tmem74	G	A	15: 43,867,468	L60F	probably benign	Het
Trhde	C	T	10: 114,800,871	G144S	possibly damaging	Het
Trrap	T	C	5: 144,814,523	S1610P	probably benign	Het
Ttc33	C	T	15: 5,217,237	Q175*	probably null	Het
Usp34	A	G	11: 23,333,566	T106A	probably benign	Het
Vmn1r204	A	G	13: 22,556,997	D266G	probably benign	Het
Wdfy3	C	A	5: 101,855,523	A2905S	probably benign	Het
Wfs1	A	G	5: 36,967,846	L567P	probably damaging	Het
Zfp42	T	C	8: 43,296,275	E63G	probably damaging	Het
Zfp957	A	G	14: 79,213,640	F240L	probably damaging	Het
Zgrf1	A	T	3: 127,563,569	M815L	probably benign	Het

Other mutations in Itga11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Itga11	APN	9	62769305	missense	possibly damaging	0.58
IGL01108:Itga11	APN	9	62757621	missense	probably benign
IGL01348:Itga11	APN	9	62744579	missense	possibly damaging	0.83
IGL01739:Itga11	APN	9	62774117	missense	probably benign	0.03
IGL01918:Itga11	APN	9	62772996	missense	probably benign	0.05
IGL02237:Itga11	APN	9	62755775	critical splice donor site	probably null
IGL02418:Itga11	APN	9	62744632	missense	probably benign	0.30
IGL02451:Itga11	APN	9	62735353	missense	probably damaging	1.00
sneezy	UTSW	9	62732109	missense	probably damaging	1.00
PIT4812001:Itga11	UTSW	9	62732193	missense	probably damaging	1.00
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0101:Itga11	UTSW	9	62744486	missense	probably damaging	1.00
R0114:Itga11	UTSW	9	62735293	missense	probably damaging	1.00
R0114:Itga11	UTSW	9	62760302	missense	possibly damaging	0.85
R0212:Itga11	UTSW	9	62745969	missense	probably benign	0.22
R0310:Itga11	UTSW	9	62760346	missense	probably damaging	1.00
R0455:Itga11	UTSW	9	62696961	missense	probably damaging	1.00
R0558:Itga11	UTSW	9	62752288	missense	probably benign	0.01
R0607:Itga11	UTSW	9	62774371	missense	probably benign	0.00
R0924:Itga11	UTSW	9	62776674	missense	probably benign	0.14
R1085:Itga11	UTSW	9	62677970	missense	probably benign	0.03
R1477:Itga11	UTSW	9	62755211	missense	probably benign
R1647:Itga11	UTSW	9	62760370	missense	probably benign	0.01
R1831:Itga11	UTSW	9	62782018	missense	probably damaging	1.00
R1880:Itga11	UTSW	9	62677949	missense	probably benign	0.06
R1934:Itga11	UTSW	9	62744514	missense	probably damaging	1.00
R2025:Itga11	UTSW	9	62762811	missense	probably damaging	1.00
R2046:Itga11	UTSW	9	62727697	missense	probably damaging	1.00
R2145:Itga11	UTSW	9	62732204	splice site	probably benign
R2922:Itga11	UTSW	9	62768630	splice site	probably benign
R3011:Itga11	UTSW	9	62696980	missense	probably damaging	0.99
R3158:Itga11	UTSW	9	62769278	missense	probably benign	0.02
R3809:Itga11	UTSW	9	62771382	missense	probably benign
R3836:Itga11	UTSW	9	62769283	missense	probably benign	0.00
R4051:Itga11	UTSW	9	62755651	nonsense	probably null
R4190:Itga11	UTSW	9	62732109	missense	probably damaging	1.00
R4510:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4511:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4678:Itga11	UTSW	9	62735357	missense	probably damaging	0.98
R4706:Itga11	UTSW	9	62755296	missense	possibly damaging	0.64
R4713:Itga11	UTSW	9	62765788	missense	probably damaging	1.00
R4798:Itga11	UTSW	9	62776727	splice site	probably null
R4909:Itga11	UTSW	9	62755299	missense	probably damaging	1.00
R4915:Itga11	UTSW	9	62752248	nonsense	probably null
R4957:Itga11	UTSW	9	62767648	missense	probably benign	0.00
R4962:Itga11	UTSW	9	62761568	nonsense	probably null
R5081:Itga11	UTSW	9	62755196	missense	probably benign	0.13
R5265:Itga11	UTSW	9	62737412	missense	probably benign	0.05
R5308:Itga11	UTSW	9	62755769	missense	probably benign
R5398:Itga11	UTSW	9	62745923	missense	probably benign	0.21
R5717:Itga11	UTSW	9	62752249	missense	probably benign	0.26
R5885:Itga11	UTSW	9	62762850	missense	probably damaging	0.99
R5996:Itga11	UTSW	9	62755673	missense	probably benign	0.01
R6394:Itga11	UTSW	9	62735266	splice site	probably null
R6751:Itga11	UTSW	9	62768584	missense	probably benign	0.02
R7041:Itga11	UTSW	9	62752256	missense	probably damaging	1.00
R7509:Itga11	UTSW	9	62781940	missense	probably benign
R7601:Itga11	UTSW	9	62696926	missense	probably benign	0.18
R7615:Itga11	UTSW	9	62744018	missense	probably benign	0.00
R8263:Itga11	UTSW	9	62696980	missense	possibly damaging	0.86
R8285:Itga11	UTSW	9	62752258	missense	probably damaging	1.00
R8419:Itga11	UTSW	9	62755178	missense	possibly damaging	0.59
R8422:Itga11	UTSW	9	62767678	missense	probably benign	0.00
R8469:Itga11	UTSW	9	62771398	missense	probably benign	0.00
R8475:Itga11	UTSW	9	62744045	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGTGATAAGCCTTAGGTACCAG -3'
(R):5'- TTCTAGGAGGCAAAGAGACACC -3'

Sequencing Primer
(F):5'- TGATAAGCCTTAGGTACCAGCAACC -3'
(R):5'- GGTAGGAGGACAGCTAGACC -3'

Posted On

2019-06-26