Incidental Mutation 'R7264:Usp34'
ID 564822
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 045354-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R7264 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23283566 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 106 (T106A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000137823
AA Change: T106A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: T106A

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180046
AA Change: T87A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: T87A

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 C A 3: 105,812,141 (GRCm39) T9K probably benign Het
Ankib1 T A 5: 3,805,739 (GRCm39) N176I probably damaging Het
Ankle2 G A 5: 110,385,689 (GRCm39) G346D probably damaging Het
Anks1b T A 10: 90,348,732 (GRCm39) M800K probably benign Het
Arhgef16 C T 4: 154,365,387 (GRCm39) G576D probably damaging Het
C2cd2 C A 16: 97,677,419 (GRCm39) probably null Het
Cacna1c T C 6: 118,579,156 (GRCm39) N1847S Het
Camta1 A G 4: 151,537,856 (GRCm39) I108T probably damaging Het
Catsper4 TTCTC TTC 4: 133,954,423 (GRCm39) probably null Het
Cep192 A G 18: 67,953,426 (GRCm39) Y481C probably damaging Het
Cep250 A G 2: 155,821,071 (GRCm39) E887G probably damaging Het
Clcn1 C A 6: 42,275,772 (GRCm39) A298D probably damaging Het
Col11a1 A G 3: 113,979,248 (GRCm39) N1305S unknown Het
Depdc5 T C 5: 33,125,089 (GRCm39) V1155A probably benign Het
Dnah1 A T 14: 30,991,851 (GRCm39) D3050E probably benign Het
Dnah7a T C 1: 53,557,973 (GRCm39) D2147G probably benign Het
Fbxl4 T C 4: 22,386,145 (GRCm39) Y251H possibly damaging Het
Gm19410 A G 8: 36,252,920 (GRCm39) M622V probably benign Het
Gm3402 T A 5: 146,451,472 (GRCm39) M110K probably damaging Het
Gm8257 T A 14: 44,893,817 (GRCm39) E82D probably damaging Het
Gne T A 4: 44,042,175 (GRCm39) I498F probably damaging Het
Grep1 A G 17: 23,931,308 (GRCm39) S200P not run Het
Gstcd C T 3: 132,790,540 (GRCm39) V76I probably benign Het
Hgs G T 11: 120,365,139 (GRCm39) V176L probably benign Het
Hrob T A 11: 102,146,422 (GRCm39) C233S probably benign Het
Igbp1b T C 6: 138,635,108 (GRCm39) N112S possibly damaging Het
Itga11 A T 9: 62,653,190 (GRCm39) T355S probably benign Het
Lama1 A T 17: 68,050,292 (GRCm39) H301L Het
Lhx9 T C 1: 138,760,489 (GRCm39) D296G probably damaging Het
Lrp1 C T 10: 127,427,962 (GRCm39) G537D probably damaging Het
Mroh2b A G 15: 4,950,844 (GRCm39) I581V possibly damaging Het
Mrps36 A G 13: 100,875,707 (GRCm39) S36P probably benign Het
Or52z13 T A 7: 103,246,955 (GRCm39) I144N probably damaging Het
Plcb4 A T 2: 135,807,000 (GRCm39) N547I probably benign Het
Plch2 T A 4: 155,083,424 (GRCm39) M505L probably damaging Het
Prg4 T A 1: 150,329,818 (GRCm39) N154Y not run Het
Rev1 A T 1: 38,124,682 (GRCm39) V420D probably damaging Het
Rin3 A G 12: 102,356,374 (GRCm39) I972V probably benign Het
Rtel1 T C 2: 180,993,654 (GRCm39) L775P not run Het
Scarf2 G T 16: 17,621,154 (GRCm39) C274F possibly damaging Het
Serinc2 C T 4: 130,152,052 (GRCm39) V271I probably benign Het
Slpi C A 2: 164,198,322 (GRCm39) probably benign Het
Spopfm1 C T 3: 94,173,045 (GRCm39) H14Y possibly damaging Het
Stxbp6 T C 12: 44,948,782 (GRCm39) D109G probably damaging Het
Tmem74 G A 15: 43,730,864 (GRCm39) L60F probably benign Het
Trhde C T 10: 114,636,776 (GRCm39) G144S possibly damaging Het
Trrap T C 5: 144,751,333 (GRCm39) S1610P probably benign Het
Ttc33 C T 15: 5,246,718 (GRCm39) Q175* probably null Het
Vmn1r204 A G 13: 22,741,167 (GRCm39) D266G probably benign Het
Wdfy3 C A 5: 102,003,389 (GRCm39) A2905S probably benign Het
Wfs1 A G 5: 37,125,190 (GRCm39) L567P probably damaging Het
Zfp42 T C 8: 43,749,312 (GRCm39) E63G probably damaging Het
Zfp957 A G 14: 79,451,080 (GRCm39) F240L probably damaging Het
Zgrf1 A T 3: 127,357,218 (GRCm39) M815L probably benign Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATGAATACAGAGCTGCCCTAG -3'
(R):5'- AGAACTCTTTGAAGATTCCTCCTC -3'

Sequencing Primer
(F):5'- AAATGTGTATTGTTCCCTCTCTAGG -3'
(R):5'- GATTCCTCCTCAGTCAGATTACAAG -3'
Posted On 2019-06-26