Mutagenetix > Incidental Mutations

Incidental Mutation 'R7264:Mroh2b'

564832

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R7264 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4921362 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 581 (I581V)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045736
AA Change: I581V

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: I581V

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	A	G	17: 23,712,334	S200P	not run	Het
Adora3	C	A	3: 105,904,825	T9K	probably benign	Het
Ankib1	T	A	5: 3,755,739	N176I	probably damaging	Het
Ankle2	G	A	5: 110,237,823	G346D	probably damaging	Het
Anks1b	T	A	10: 90,512,870	M800K	probably benign	Het
Arhgef16	C	T	4: 154,280,930	G576D	probably damaging	Het
BC030867	T	A	11: 102,255,596	C233S	probably benign	Het
C2cd2	C	A	16: 97,876,219		probably null	Het
Cacna1c	T	C	6: 118,602,195	N1847S		Het
Camta1	A	G	4: 151,453,399	I108T	probably damaging	Het
Catsper4	TTCTC	TTC	4: 134,227,112		probably null	Het
Cep192	A	G	18: 67,820,355	Y481C	probably damaging	Het
Cep250	A	G	2: 155,979,151	E887G	probably damaging	Het
Clcn1	C	A	6: 42,298,838	A298D	probably damaging	Het
Col11a1	A	G	3: 114,185,599	N1305S	unknown	Het
Depdc5	T	C	5: 32,967,745	V1155A	probably benign	Het
Dnah1	A	T	14: 31,269,894	D3050E	probably benign	Het
Dnah7a	T	C	1: 53,518,814	D2147G	probably benign	Het
Fbxl4	T	C	4: 22,386,145	Y251H	possibly damaging	Het
Gm19410	A	G	8: 35,785,766	M622V	probably benign	Het
Gm3402	T	A	5: 146,514,662	M110K	probably damaging	Het
Gm4778	C	T	3: 94,265,738	H14Y	possibly damaging	Het
Gm8257	T	A	14: 44,656,360	E82D	probably damaging	Het
Gne	T	A	4: 44,042,175	I498F	probably damaging	Het
Gstcd	C	T	3: 133,084,779	V76I	probably benign	Het
Hgs	G	T	11: 120,474,313	V176L	probably benign	Het
Igbp1b	T	C	6: 138,658,110	N112S	possibly damaging	Het
Itga11	A	T	9: 62,745,908	T355S	probably benign	Het
Lama1	A	T	17: 67,743,297	H301L		Het
Lhx9	T	C	1: 138,832,751	D296G	probably damaging	Het
Lrp1	C	T	10: 127,592,093	G537D	probably damaging	Het
Mrps36	A	G	13: 100,739,199	S36P	probably benign	Het
Olfr618	T	A	7: 103,597,748	I144N	probably damaging	Het
Plcb4	A	T	2: 135,965,080	N547I	probably benign	Het
Plch2	T	A	4: 154,998,967	M505L	probably damaging	Het
Prg4	T	A	1: 150,454,067	N154Y	not run	Het
Rev1	A	T	1: 38,085,601	V420D	probably damaging	Het
Rin3	A	G	12: 102,390,115	I972V	probably benign	Het
Rtel1	T	C	2: 181,351,861	L775P	not run	Het
Scarf2	G	T	16: 17,803,290	C274F	possibly damaging	Het
Serinc2	C	T	4: 130,258,259	V271I	probably benign	Het
Slpi	C	A	2: 164,356,402		probably benign	Het
Stxbp6	T	C	12: 44,901,999	D109G	probably damaging	Het
Tmem74	G	A	15: 43,867,468	L60F	probably benign	Het
Trhde	C	T	10: 114,800,871	G144S	possibly damaging	Het
Trrap	T	C	5: 144,814,523	S1610P	probably benign	Het
Ttc33	C	T	15: 5,217,237	Q175*	probably null	Het
Usp34	A	G	11: 23,333,566	T106A	probably benign	Het
Vmn1r204	A	G	13: 22,556,997	D266G	probably benign	Het
Wdfy3	C	A	5: 101,855,523	A2905S	probably benign	Het
Wfs1	A	G	5: 36,967,846	L567P	probably damaging	Het
Zfp42	T	C	8: 43,296,275	E63G	probably damaging	Het
Zfp957	A	G	14: 79,213,640	F240L	probably damaging	Het
Zgrf1	A	T	3: 127,563,569	M815L	probably benign	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGGCACACAAGGATGGAG -3'
(R):5'- AGGGACCTAAGGGAACTCTTTC -3'

Sequencing Primer
(F):5'- GCACACAAGGATGGAGTTTTTCC -3'
(R):5'- AACTCTTTCCTCTAGCCATTCTTTTC -3'

Posted On

2019-06-26