Incidental Mutation 'R0582:Ints9'
ID 56484
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Name integrator complex subunit 9
Synonyms D14Ertd231e
MMRRC Submission 038772-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0582 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 65187494-65277284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65217598 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 42 (P42S)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043914]
AlphaFold Q8K114
Predicted Effect probably damaging
Transcript: ENSMUST00000043914
AA Change: P42S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: P42S

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225790
Meta Mutation Damage Score 0.7584 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,904,147 (GRCm39) M186K probably benign Het
Afm T C 5: 90,672,639 (GRCm39) probably benign Het
Arfgef3 G A 10: 18,487,038 (GRCm39) A1332V probably damaging Het
Atp11a T C 8: 12,881,214 (GRCm39) S451P probably benign Het
Birc6 T A 17: 74,950,332 (GRCm39) V3189E probably damaging Het
Ccdc150 C T 1: 54,368,670 (GRCm39) A626V probably benign Het
Ccdc50 G A 16: 27,263,409 (GRCm39) probably benign Het
Cntln T C 4: 84,802,978 (GRCm39) S93P probably damaging Het
Ctnna2 C A 6: 77,735,400 (GRCm39) V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 (GRCm39) Q668E probably damaging Het
Cyp1a2 G A 9: 57,587,529 (GRCm39) probably benign Het
Dnah8 A G 17: 30,937,935 (GRCm39) D1604G probably benign Het
Dscaml1 A T 9: 45,579,562 (GRCm39) I370F possibly damaging Het
Duxf4 A T 10: 58,071,508 (GRCm39) S235R probably benign Het
Ears2 T C 7: 121,654,881 (GRCm39) E129G probably benign Het
Igsf10 T C 3: 59,227,188 (GRCm39) I2162V probably benign Het
Ipp T C 4: 116,372,664 (GRCm39) L231S probably damaging Het
Lyn T A 4: 3,743,296 (GRCm39) L72Q probably damaging Het
Nfe2l2 T A 2: 75,507,112 (GRCm39) E329D probably damaging Het
Or2h2c G C 17: 37,422,347 (GRCm39) L176V probably benign Het
Or52a24 G A 7: 103,381,880 (GRCm39) C249Y possibly damaging Het
Pdyn A C 2: 129,531,658 (GRCm39) L44R probably damaging Het
Pkd1l1 A G 11: 8,881,699 (GRCm39) probably benign Het
Prpf40a A T 2: 53,035,704 (GRCm39) F695L probably damaging Het
Rnf217 A G 10: 31,484,763 (GRCm39) Y140H possibly damaging Het
Sema6c C T 3: 95,076,508 (GRCm39) R265C probably damaging Het
Slc7a8 C A 14: 54,995,901 (GRCm39) C167F probably damaging Het
Snap47 A T 11: 59,319,259 (GRCm39) L293* probably null Het
Snx3 A T 10: 42,409,276 (GRCm39) probably benign Het
Sycp2l T A 13: 41,291,431 (GRCm39) probably benign Het
Taar3 A G 10: 23,825,715 (GRCm39) Y87C probably damaging Het
Tm4sf4 T C 3: 57,341,278 (GRCm39) probably benign Het
Tssc4 T C 7: 142,624,246 (GRCm39) S185P probably damaging Het
Ttc28 G T 5: 111,331,162 (GRCm39) A430S probably damaging Het
Ulbp3 G A 10: 3,075,082 (GRCm39) noncoding transcript Het
Vmn2r27 T C 6: 124,201,249 (GRCm39) D236G probably benign Het
Vps54 G T 11: 21,250,137 (GRCm39) D508Y probably damaging Het
Wdr53 G A 16: 32,070,726 (GRCm39) V24M probably damaging Het
Xirp2 T G 2: 67,339,210 (GRCm39) L484V probably benign Het
Zfyve26 T C 12: 79,292,996 (GRCm39) D2051G probably damaging Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65,274,870 (GRCm39) missense probably benign 0.00
IGL02374:Ints9 APN 14 65,276,782 (GRCm39) missense probably benign 0.00
IGL02728:Ints9 APN 14 65,230,457 (GRCm39) missense probably damaging 1.00
IGL02992:Ints9 APN 14 65,217,613 (GRCm39) missense probably benign 0.08
IGL03151:Ints9 APN 14 65,269,789 (GRCm39) missense possibly damaging 0.86
R0437:Ints9 UTSW 14 65,223,818 (GRCm39) splice site probably benign
R1525:Ints9 UTSW 14 65,232,460 (GRCm39) missense probably benign 0.05
R1569:Ints9 UTSW 14 65,217,571 (GRCm39) missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65,269,705 (GRCm39) missense probably damaging 1.00
R1839:Ints9 UTSW 14 65,253,979 (GRCm39) missense probably damaging 1.00
R1862:Ints9 UTSW 14 65,263,862 (GRCm39) missense probably benign
R1892:Ints9 UTSW 14 65,257,872 (GRCm39) missense probably benign 0.08
R2146:Ints9 UTSW 14 65,223,792 (GRCm39) missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65,245,446 (GRCm39) missense possibly damaging 0.61
R3015:Ints9 UTSW 14 65,187,727 (GRCm39) missense probably benign 0.00
R4133:Ints9 UTSW 14 65,228,003 (GRCm39) missense probably benign
R4180:Ints9 UTSW 14 65,230,430 (GRCm39) missense probably damaging 1.00
R4509:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65,269,729 (GRCm39) missense possibly damaging 0.82
R5023:Ints9 UTSW 14 65,217,677 (GRCm39) missense probably damaging 1.00
R5117:Ints9 UTSW 14 65,230,540 (GRCm39) nonsense probably null
R5261:Ints9 UTSW 14 65,245,521 (GRCm39) missense probably benign 0.25
R5582:Ints9 UTSW 14 65,266,345 (GRCm39) missense possibly damaging 0.83
R5990:Ints9 UTSW 14 65,276,777 (GRCm39) missense probably damaging 1.00
R6009:Ints9 UTSW 14 65,245,531 (GRCm39) missense probably benign 0.43
R6241:Ints9 UTSW 14 65,217,659 (GRCm39) missense possibly damaging 0.90
R6351:Ints9 UTSW 14 65,230,456 (GRCm39) missense probably damaging 0.98
R6821:Ints9 UTSW 14 65,274,907 (GRCm39) missense probably benign 0.20
R7422:Ints9 UTSW 14 65,269,747 (GRCm39) missense possibly damaging 0.93
R7442:Ints9 UTSW 14 65,232,513 (GRCm39) nonsense probably null
R7475:Ints9 UTSW 14 65,263,914 (GRCm39) missense probably null 0.23
R8183:Ints9 UTSW 14 65,273,902 (GRCm39) missense probably damaging 0.98
R8223:Ints9 UTSW 14 65,257,809 (GRCm39) missense possibly damaging 0.94
R8282:Ints9 UTSW 14 65,244,757 (GRCm39) missense probably benign 0.00
R8314:Ints9 UTSW 14 65,266,479 (GRCm39) missense probably damaging 1.00
R8341:Ints9 UTSW 14 65,273,863 (GRCm39) missense probably benign 0.14
R8548:Ints9 UTSW 14 65,269,770 (GRCm39) missense probably benign 0.39
R9356:Ints9 UTSW 14 65,269,770 (GRCm39) missense probably benign 0.39
R9434:Ints9 UTSW 14 65,245,506 (GRCm39) missense probably benign 0.00
Z1176:Ints9 UTSW 14 65,274,903 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCACACAGAAGGCTATATGAGTCCA -3'
(R):5'- ACCCCAGTTACACCGAGCAGTT -3'

Sequencing Primer
(F):5'- GGCTATATGAGTCCACACACTATC -3'
(R):5'- TTCATATAACAGTTTTAAGGGGGTG -3'
Posted On 2013-07-11