Mutagenetix > Incidental Mutations

Incidental Mutation 'R0582:Ints9'

56484

Institutional Source

Beutler Lab

Gene Symbol

Ints9

Ensembl Gene

ENSMUSG00000021975

Gene Name

integrator complex subunit 9

Synonyms

D14Ertd231e

MMRRC Submission

038772-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0582 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64950045-65039832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 64980149 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 42 (P42S)

Ref Sequence

ENSEMBL: ENSMUSP00000045552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043914]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043914
AA Change: P42S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: P42S

Domain	Start	End	E-Value	Type
Pfam:Lactamase_B_6	91	289	1.2e-17	PFAM
Beta-Casp	334	462	7.65e-16	SMART
low complexity region	583	596	N/A	INTRINSIC
low complexity region	672	682	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225790

Meta Mutation Damage Score

0.7584

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.6%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	G	A	10: 3,125,082		noncoding transcript	Het
Abcb5	A	T	12: 118,940,412	M186K	probably benign	Het
Afm	T	C	5: 90,524,780		probably benign	Het
Arfgef3	G	A	10: 18,611,290	A1332V	probably damaging	Het
Atp11a	T	C	8: 12,831,214	S451P	probably benign	Het
Birc6	T	A	17: 74,643,337	V3189E	probably damaging	Het
Ccdc150	C	T	1: 54,329,511	A626V	probably benign	Het
Ccdc50	G	A	16: 27,444,659		probably benign	Het
Cntln	T	C	4: 84,884,741	S93P	probably damaging	Het
Ctnna2	C	A	6: 77,758,417	V106L	probably benign	Het
Ctnnal1	G	C	4: 56,813,228	Q668E	probably damaging	Het
Cyp1a2	G	A	9: 57,680,246		probably benign	Het
Dnah8	A	G	17: 30,718,961	D1604G	probably benign	Het
Dscaml1	A	T	9: 45,668,264	I370F	possibly damaging	Het
Ears2	T	C	7: 122,055,658	E129G	probably benign	Het
Gm4981	A	T	10: 58,235,686	S235R	probably benign	Het
Igsf10	T	C	3: 59,319,767	I2162V	probably benign	Het
Ipp	T	C	4: 116,515,467	L231S	probably damaging	Het
Lyn	T	A	4: 3,743,296	L72Q	probably damaging	Het
Nfe2l2	T	A	2: 75,676,768	E329D	probably damaging	Het
Olfr628	G	A	7: 103,732,673	C249Y	possibly damaging	Het
Olfr92	G	C	17: 37,111,455	L176V	probably benign	Het
Pdyn	A	C	2: 129,689,738	L44R	probably damaging	Het
Pkd1l1	A	G	11: 8,931,699		probably benign	Het
Prpf40a	A	T	2: 53,145,692	F695L	probably damaging	Het
Rnf217	A	G	10: 31,608,767	Y140H	possibly damaging	Het
Sema6c	C	T	3: 95,169,197	R265C	probably damaging	Het
Slc7a8	C	A	14: 54,758,444	C167F	probably damaging	Het
Snap47	A	T	11: 59,428,433	L293*	probably null	Het
Snx3	A	T	10: 42,533,280		probably benign	Het
Sycp2l	T	A	13: 41,137,955		probably benign	Het
Taar3	A	G	10: 23,949,817	Y87C	probably damaging	Het
Tm4sf4	T	C	3: 57,433,857		probably benign	Het
Tssc4	T	C	7: 143,070,509	S185P	probably damaging	Het
Ttc28	G	T	5: 111,183,296	A430S	probably damaging	Het
Vmn2r27	T	C	6: 124,224,290	D236G	probably benign	Het
Vps54	G	T	11: 21,300,137	D508Y	probably damaging	Het
Wdr53	G	A	16: 32,251,908	V24M	probably damaging	Het
Xirp2	T	G	2: 67,508,866	L484V	probably benign	Het
Zfyve26	T	C	12: 79,246,222	D2051G	probably damaging	Het

Other mutations in Ints9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Ints9	APN	14	65037421	missense	probably benign	0.00
IGL02374:Ints9	APN	14	65039333	missense	probably benign	0.00
IGL02728:Ints9	APN	14	64993008	missense	probably damaging	1.00
IGL02992:Ints9	APN	14	64980164	missense	probably benign	0.08
IGL03151:Ints9	APN	14	65032340	missense	possibly damaging	0.86
R0437:Ints9	UTSW	14	64986369	splice site	probably benign
R1525:Ints9	UTSW	14	64995011	missense	probably benign	0.05
R1569:Ints9	UTSW	14	64980122	missense	possibly damaging	0.91
R1835:Ints9	UTSW	14	65032256	missense	probably damaging	1.00
R1839:Ints9	UTSW	14	65016530	missense	probably damaging	1.00
R1862:Ints9	UTSW	14	65026413	missense	probably benign
R1892:Ints9	UTSW	14	65020423	missense	probably benign	0.08
R2146:Ints9	UTSW	14	64986343	missense	possibly damaging	0.71
R2285:Ints9	UTSW	14	65007997	missense	possibly damaging	0.61
R3015:Ints9	UTSW	14	64950278	missense	probably benign	0.00
R4133:Ints9	UTSW	14	64990554	missense	probably benign
R4180:Ints9	UTSW	14	64992981	missense	probably damaging	1.00
R4509:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4510:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4511:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4608:Ints9	UTSW	14	65032280	missense	possibly damaging	0.82
R5023:Ints9	UTSW	14	64980228	missense	probably damaging	1.00
R5117:Ints9	UTSW	14	64993091	nonsense	probably null
R5261:Ints9	UTSW	14	65008072	missense	probably benign	0.25
R5582:Ints9	UTSW	14	65028896	missense	possibly damaging	0.83
R5990:Ints9	UTSW	14	65039328	missense	probably damaging	1.00
R6009:Ints9	UTSW	14	65008082	missense	probably benign	0.43
R6241:Ints9	UTSW	14	64980210	missense	possibly damaging	0.90
R6351:Ints9	UTSW	14	64993007	missense	probably damaging	0.98
R6821:Ints9	UTSW	14	65037458	missense	probably benign	0.20
R7422:Ints9	UTSW	14	65032298	missense	possibly damaging	0.93
R7442:Ints9	UTSW	14	64995064	nonsense	probably null
R7475:Ints9	UTSW	14	65026465	missense	probably null	0.23
Z1176:Ints9	UTSW	14	65037454	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTCACACAGAAGGCTATATGAGTCCA -3'
(R):5'- ACCCCAGTTACACCGAGCAGTT -3'

Sequencing Primer
(F):5'- GGCTATATGAGTCCACACACTATC -3'
(R):5'- TTCATATAACAGTTTTAAGGGGGTG -3'

Posted On

2013-07-11