Incidental Mutation 'R7265:Sctr'
ID564841
Institutional Source Beutler Lab
Gene Symbol Sctr
Ensembl Gene ENSMUSG00000026387
Gene Namesecretin receptor
Synonyms6530402O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location120006894-120063536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120022225 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 48 (R48Q)
Ref Sequence ENSEMBL: ENSMUSP00000139932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072886] [ENSMUST00000189037]
Predicted Effect probably benign
Transcript: ENSMUST00000072886
AA Change: R48Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072660
Gene: ENSMUSG00000026387
AA Change: R48Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 53 N/A INTRINSIC
HormR 76 146 5.18e-21 SMART
Pfam:7tm_2 153 398 3.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189037
AA Change: R48Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139932
Gene: ENSMUSG00000026387
AA Change: R48Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 53 N/A INTRINSIC
HormR 61 131 2.59e-21 SMART
Pfam:7tm_2 138 383 1.9e-89 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor and belongs to the glucagon-VIP-secretin receptor family. It binds secretin which is the most potent regulator of pancreatic bicarbonate, electrolyte and volume secretion. Secretin and its receptor are suggested to be involved in pancreatic cancer and autism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show polydipsia, polyuria, decreased urine osmolality, higher serum glucose levels, kidney glomerular and tubular pathology, and impaired renal water reabsorption. Homozygotes for a different null allele show impaired synaptic plasticity and social behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Sctr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Sctr APN 1 120044720 missense probably damaging 1.00
IGL01542:Sctr APN 1 120044769 splice site probably benign
IGL02798:Sctr APN 1 120022180 missense probably damaging 1.00
IGL02850:Sctr APN 1 120044663 missense possibly damaging 0.95
IGL02850:Sctr APN 1 120022179 missense probably damaging 1.00
IGL03256:Sctr APN 1 120031559 splice site probably benign
PIT4677001:Sctr UTSW 1 120061904 missense probably damaging 1.00
R0018:Sctr UTSW 1 120043556 splice site probably benign
R0166:Sctr UTSW 1 120055394 missense probably damaging 0.97
R1678:Sctr UTSW 1 120036439 critical splice donor site probably null
R1728:Sctr UTSW 1 120031656 missense probably benign 0.00
R1728:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1729:Sctr UTSW 1 120031656 missense probably benign 0.00
R1729:Sctr UTSW 1 120063246 missense probably benign 0.16
R1729:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1730:Sctr UTSW 1 120031656 missense probably benign 0.00
R1730:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1739:Sctr UTSW 1 120031656 missense probably benign 0.00
R1739:Sctr UTSW 1 120063246 missense probably benign 0.16
R1739:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1762:Sctr UTSW 1 120031656 missense probably benign 0.00
R1762:Sctr UTSW 1 120063246 missense probably benign 0.16
R1762:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1783:Sctr UTSW 1 120031656 missense probably benign 0.00
R1785:Sctr UTSW 1 120031656 missense probably benign 0.00
R1785:Sctr UTSW 1 120063246 missense probably benign 0.16
R1785:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R2116:Sctr UTSW 1 120031582 missense probably damaging 1.00
R5522:Sctr UTSW 1 120036416 missense probably benign 0.10
R5776:Sctr UTSW 1 120056407 missense probably damaging 1.00
R5781:Sctr UTSW 1 120031620 missense probably damaging 0.99
R6333:Sctr UTSW 1 120056452 missense probably damaging 1.00
R7084:Sctr UTSW 1 120063271 missense possibly damaging 0.77
R7263:Sctr UTSW 1 120022225 missense probably benign
R7266:Sctr UTSW 1 120022225 missense probably benign
R7304:Sctr UTSW 1 120022240 missense probably damaging 1.00
R7343:Sctr UTSW 1 120022225 missense probably benign
R8063:Sctr UTSW 1 120063275 missense probably benign 0.09
X0067:Sctr UTSW 1 120007299 missense probably benign
Z1088:Sctr UTSW 1 120036406 frame shift probably null
Z1176:Sctr UTSW 1 120022249 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTCCTGCAACGTTGGAG -3'
(R):5'- TCCGACAGCTGATTGAGTG -3'

Sequencing Primer
(F):5'- CCTGCAACGTTGGAGCTAATG -3'
(R):5'- TCCGACAGCTGATTGAGTGTACAG -3'
Posted On2019-06-26