Incidental Mutation 'R7265:Pak7'
ID564846
Institutional Source Beutler Lab
Gene Symbol Pak7
Ensembl Gene ENSMUSG00000039913
Gene Namep21 (RAC1) activated kinase 7
Synonyms2900083L08Rik, Pak5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location136081104-136387967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136101185 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 345 (S345L)
Ref Sequence ENSEMBL: ENSMUSP00000047285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035264] [ENSMUST00000077200]
Predicted Effect probably benign
Transcript: ENSMUST00000035264
AA Change: S345L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000047285
Gene: ENSMUSG00000039913
AA Change: S345L

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077200
AA Change: S345L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000076440
Gene: ENSMUSG00000039913
AA Change: S345L

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PAK family of Ser/Thr protein kinases. PAK family members are known to be effectors of Rac/Cdc42 GTPases, which have been implicated in the regulation of cytoskeletal dynamics, proliferation, and cell survival signaling. This kinase contains a CDC42/Rac1 interactive binding (CRIB) motif, and has been shown to bind CDC42 in the presence of GTP. This kinase is predominantly expressed in brain. It is capable of promoting neurite outgrowth, and thus may play a role in neurite development. This kinase is associated with microtubule networks and induces microtubule stabilization. The subcellular localization of this kinase is tightly regulated during cell cycle progression. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit impaired active avoidance learning but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Pak7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Pak7 APN 2 136116373 missense possibly damaging 0.89
IGL01743:Pak7 APN 2 136087413 missense probably damaging 1.00
IGL02601:Pak7 APN 2 136116935 nonsense probably null
IGL03172:Pak7 APN 2 136098390 nonsense probably null
currency UTSW 2 136100939 missense probably benign 0.15
Depreciation UTSW 2 136097534 missense probably damaging 1.00
PIT4498001:Pak7 UTSW 2 136083291 missense probably damaging 1.00
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0400:Pak7 UTSW 2 136097579 missense possibly damaging 0.95
R0441:Pak7 UTSW 2 136116629 missense probably benign
R1653:Pak7 UTSW 2 136116887 missense probably damaging 1.00
R1662:Pak7 UTSW 2 136116760 missense probably damaging 0.96
R1855:Pak7 UTSW 2 136087509 missense probably benign 0.00
R1872:Pak7 UTSW 2 136085588 missense possibly damaging 0.93
R2001:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2002:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2157:Pak7 UTSW 2 136100957 missense probably damaging 0.96
R2160:Pak7 UTSW 2 136098382 missense probably benign 0.01
R2217:Pak7 UTSW 2 136116203 missense probably damaging 1.00
R3797:Pak7 UTSW 2 136100826 missense probably benign 0.06
R4711:Pak7 UTSW 2 136087517 missense probably damaging 1.00
R4904:Pak7 UTSW 2 136083347 missense probably benign 0.02
R5090:Pak7 UTSW 2 136087418 missense probably damaging 1.00
R5120:Pak7 UTSW 2 136083229 missense probably damaging 0.97
R5669:Pak7 UTSW 2 136116284 missense probably damaging 1.00
R5954:Pak7 UTSW 2 136116463 missense probably benign 0.01
R6127:Pak7 UTSW 2 136087406 missense probably damaging 0.99
R6250:Pak7 UTSW 2 136174269 start gained probably benign
R6471:Pak7 UTSW 2 136116190 missense probably benign 0.00
R6797:Pak7 UTSW 2 136097534 missense probably damaging 1.00
R6809:Pak7 UTSW 2 136097581 missense possibly damaging 0.83
R6945:Pak7 UTSW 2 136100939 missense probably benign 0.15
R7254:Pak7 UTSW 2 136116764 missense possibly damaging 0.50
R7335:Pak7 UTSW 2 136098299 missense probably damaging 1.00
R7511:Pak7 UTSW 2 136083324 missense possibly damaging 0.87
R7573:Pak7 UTSW 2 136116305 missense probably damaging 1.00
R7593:Pak7 UTSW 2 136100964 missense probably benign 0.40
R7908:Pak7 UTSW 2 136116559 missense probably benign 0.14
R7989:Pak7 UTSW 2 136116559 missense probably benign 0.14
Z1176:Pak7 UTSW 2 136083246 missense not run
Predicted Primers PCR Primer
(F):5'- TAGGTGCTCGAGGAGATACTG -3'
(R):5'- TCAACTAAGCCCGTGGTTG -3'

Sequencing Primer
(F):5'- CTCGAGGAGATACTGAGAGAGC -3'
(R):5'- CACGGGTGTGGAAAAGTACTTTC -3'
Posted On2019-06-26