Incidental Mutation 'R7265:Pramef6'
ID564858
Institutional Source Beutler Lab
Gene Symbol Pramef6
Ensembl Gene ENSMUSG00000078512
Gene NamePRAME family member 6
SynonymsGm13099
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location143894237-143900380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 143895421 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 455 (V455L)
Ref Sequence ENSEMBL: ENSMUSP00000101393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081645] [ENSMUST00000081645] [ENSMUST00000081645] [ENSMUST00000105767]
Predicted Effect probably null
Transcript: ENSMUST00000081645
SMART Domains Protein: ENSMUSP00000080350
Gene: ENSMUSG00000078512

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 6e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081645
SMART Domains Protein: ENSMUSP00000080350
Gene: ENSMUSG00000078512

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 6e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081645
SMART Domains Protein: ENSMUSP00000080350
Gene: ENSMUSG00000078512

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 6e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105767
AA Change: V455L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101393
Gene: ENSMUSG00000078512
AA Change: V455L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 1e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Pramef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Pramef6 APN 4 143895631 missense probably benign
IGL01917:Pramef6 APN 4 143897714 missense probably benign 0.15
IGL02222:Pramef6 APN 4 143895846 missense possibly damaging 0.94
IGL02315:Pramef6 APN 4 143897928 start gained probably benign
R0488:Pramef6 UTSW 4 143895403 missense probably benign 0.00
R0755:Pramef6 UTSW 4 143897729 missense probably damaging 0.96
R0972:Pramef6 UTSW 4 143896963 missense probably benign 0.02
R1444:Pramef6 UTSW 4 143896891 missense probably benign 0.01
R1551:Pramef6 UTSW 4 143895693 missense probably benign 0.00
R1907:Pramef6 UTSW 4 143895491 missense possibly damaging 0.89
R2068:Pramef6 UTSW 4 143896912 missense probably damaging 1.00
R2182:Pramef6 UTSW 4 143897190 missense possibly damaging 0.60
R2246:Pramef6 UTSW 4 143897220 missense probably benign 0.19
R4483:Pramef6 UTSW 4 143895840 missense probably damaging 1.00
R5123:Pramef6 UTSW 4 143897136 missense probably benign 0.00
R5291:Pramef6 UTSW 4 143895667 missense probably damaging 1.00
R5643:Pramef6 UTSW 4 143895767 missense probably damaging 0.98
R5683:Pramef6 UTSW 4 143895853 missense probably damaging 1.00
R5836:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R5837:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R5838:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R5853:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R6340:Pramef6 UTSW 4 143897307 missense possibly damaging 0.69
R6572:Pramef6 UTSW 4 143895373 missense possibly damaging 0.79
R6791:Pramef6 UTSW 4 143895682 missense probably benign 0.02
R6972:Pramef6 UTSW 4 143896902 missense probably damaging 1.00
R7307:Pramef6 UTSW 4 143896775 nonsense probably null
R7342:Pramef6 UTSW 4 143896950 missense probably benign 0.26
R7361:Pramef6 UTSW 4 143895886 missense possibly damaging 0.88
R7480:Pramef6 UTSW 4 143895495 missense probably benign
R7685:Pramef6 UTSW 4 143897801 missense probably benign 0.28
R7861:Pramef6 UTSW 4 143897718 missense possibly damaging 0.75
R7944:Pramef6 UTSW 4 143897718 missense possibly damaging 0.75
Z1176:Pramef6 UTSW 4 143895684 missense not run
Z1177:Pramef6 UTSW 4 143897199 missense not run
Predicted Primers PCR Primer
(F):5'- GGTTTTCCATCTCAACACAACTAC -3'
(R):5'- TGGACAGCCTGAAGAAGCTG -3'

Sequencing Primer
(F):5'- CCTCAAATCAGAAGAATTTGACTGAC -3'
(R):5'- CCTGAAGAAGCTGCTGCAG -3'
Posted On2019-06-26