Incidental Mutation 'R7265:Lrrc32'
ID564871
Institutional Source Beutler Lab
Gene Symbol Lrrc32
Ensembl Gene ENSMUSG00000090958
Gene Nameleucine rich repeat containing 32
SynonymsD7H11S833E, EG434215, Garp, D11S833Eh
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location98489283-98502181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98499437 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 475 (S475P)
Ref Sequence ENSEMBL: ENSMUSP00000133205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165205] [ENSMUST00000205937] [ENSMUST00000205956]
Predicted Effect probably damaging
Transcript: ENSMUST00000165205
AA Change: S475P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133205
Gene: ENSMUSG00000090958
AA Change: S475P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:LRRNT 22 54 3e-12 BLAST
LRR_TYP 73 96 9.44e-2 SMART
LRR 97 123 1.86e2 SMART
LRR 124 148 3.01e2 SMART
LRR 149 172 5.41e0 SMART
LRR 173 196 1.51e0 SMART
LRR_TYP 197 220 7.67e-2 SMART
LRR 265 287 1.49e2 SMART
LRR 315 338 4.97e0 SMART
LRR 339 362 8.01e0 SMART
LRR 363 384 5.57e1 SMART
LRR_TYP 386 409 3.44e-4 SMART
low complexity region 425 437 N/A INTRINSIC
LRR 443 466 2.33e2 SMART
LRR 514 536 2.03e1 SMART
LRR 537 559 2.61e1 SMART
Blast:LRR 561 588 6e-11 BLAST
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205937
Predicted Effect probably damaging
Transcript: ENSMUST00000205956
AA Change: S475P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein which contains 20 leucine-rich repeats. Alterations in the chromosomal region 11q13-11q14 are involved in several pathologies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in T cells exhibit reduced regulatory T cell ability to drive Th17 differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Lrrc32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Lrrc32 APN 7 98498376 missense probably damaging 1.00
IGL01484:Lrrc32 APN 7 98494235 missense probably damaging 0.99
IGL01608:Lrrc32 APN 7 98499357 missense probably benign 0.01
IGL02025:Lrrc32 APN 7 98499560 missense probably benign 0.00
IGL02026:Lrrc32 APN 7 98499560 missense probably benign 0.00
IGL03061:Lrrc32 APN 7 98499422 missense probably benign 0.04
IGL03191:Lrrc32 APN 7 98498247 missense possibly damaging 0.66
R0706:Lrrc32 UTSW 7 98499710 missense probably damaging 1.00
R0947:Lrrc32 UTSW 7 98498883 missense probably benign
R1470:Lrrc32 UTSW 7 98499357 missense probably benign
R1470:Lrrc32 UTSW 7 98499357 missense probably benign
R2879:Lrrc32 UTSW 7 98499777 missense probably benign 0.02
R3608:Lrrc32 UTSW 7 98499186 missense probably benign 0.09
R4417:Lrrc32 UTSW 7 98498937 missense probably benign 0.01
R4798:Lrrc32 UTSW 7 98499017 missense probably damaging 1.00
R4872:Lrrc32 UTSW 7 98498520 missense probably damaging 0.99
R5813:Lrrc32 UTSW 7 98498411 missense probably damaging 1.00
R6062:Lrrc32 UTSW 7 98498541 missense probably benign 0.00
R6742:Lrrc32 UTSW 7 98498832 missense probably benign 0.00
R6930:Lrrc32 UTSW 7 98499264 missense possibly damaging 0.89
R7367:Lrrc32 UTSW 7 98498879 nonsense probably null
R7372:Lrrc32 UTSW 7 98499807 missense probably benign 0.28
R7414:Lrrc32 UTSW 7 98499994 missense probably benign 0.01
R7485:Lrrc32 UTSW 7 98498207 missense possibly damaging 0.94
R7679:Lrrc32 UTSW 7 98499687 missense possibly damaging 0.91
R7713:Lrrc32 UTSW 7 98499338 missense probably damaging 0.99
Z1088:Lrrc32 UTSW 7 98499060 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGCCTTGCAAGAACTTCCACC -3'
(R):5'- CAGGTGGCTTAACTGGTTCTC -3'

Sequencing Primer
(F):5'- GCAAGAACTTCCACCCTATACCTTTG -3'
(R):5'- TTCTCAGCAAGGTTAAGGCGC -3'
Posted On2019-06-26