Mutagenetix > Incidental Mutations

Incidental Mutation 'R7265:Muc16'

564876

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.200) question?

Stock #

R7265 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18656472 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1584 (S1584P)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

unknown
Transcript: ENSMUST00000208663
AA Change: S1584P

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	G	A	17: 33,066,997	T277I	probably damaging	Het
9330182L06Rik	T	C	5: 9,446,975	V813A	possibly damaging	Het
Asb3	A	G	11: 30,998,495	E57G	probably benign	Het
B3glct	A	G	5: 149,709,320	D45G	probably benign	Het
BC034090	C	A	1: 155,225,327	C397F	probably damaging	Het
Bicd1	A	G	6: 149,513,876	K696E	probably damaging	Het
Btnl4	C	T	17: 34,475,894	C15Y	probably benign	Het
Cabin1	T	C	10: 75,721,423	N300S		Het
Chia1	T	A	3: 106,128,923	L273Q	probably damaging	Het
Coq2	A	G	5: 100,660,270	S222P	possibly damaging	Het
Dgkb	T	C	12: 38,184,932	V432A	possibly damaging	Het
Dpp3	A	G	19: 4,923,769	F92S	probably damaging	Het
Emcn	T	C	3: 137,417,078	S183P	probably damaging	Het
Emcn	T	A	3: 137,419,076	W217R	probably damaging	Het
Enpp2	A	C	15: 54,910,033		probably null	Het
Epb41	T	C	4: 131,967,834	E14G	unknown	Het
Fam160a2	G	T	7: 105,384,225	R609S	probably benign	Het
Grk4	A	G	5: 34,716,264	R225G	probably damaging	Het
Insl6	A	T	19: 29,321,545	W156R	possibly damaging	Het
Ints3	A	T	3: 90,403,983		probably null	Het
Jarid2	G	A	13: 44,902,272	G318D	probably benign	Het
Kif16b	A	T	2: 142,714,730	L596H	probably damaging	Het
Lctl	T	A	9: 64,126,921	Y281N	probably damaging	Het
Letm1	A	T	5: 33,778,648	C34S	possibly damaging	Het
Lrrc32	T	C	7: 98,499,437	S475P	probably damaging	Het
Lrrc37a	T	A	11: 103,498,941	D1886V	probably benign	Het
Macf1	A	T	4: 123,407,877	I944K	probably benign	Het
Mark4	T	C	7: 19,451,725	D28G	probably benign	Het
Mecom	C	A	3: 29,980,133	A465S	possibly damaging	Het
Mycbp2	A	G	14: 103,197,243		probably null	Het
Myo18b	G	A	5: 112,812,072	R1372W	probably damaging	Het
Myo1c	T	C	11: 75,669,790	I706T	possibly damaging	Het
Myo1g	T	C	11: 6,510,933	T704A	possibly damaging	Het
Nwd1	A	G	8: 72,692,928	K914E	probably benign	Het
Olfr1056	C	T	2: 86,355,744	V213I	probably benign	Het
Olfr202	T	A	16: 59,283,924	D191V	probably damaging	Het
Olfr888	A	T	9: 38,108,931	I77L	possibly damaging	Het
Otub2	C	T	12: 103,400,221	S99L	probably damaging	Het
Pak7	G	A	2: 136,101,185	S345L	probably benign	Het
Pcdhb20	A	T	18: 37,505,563	I381F	possibly damaging	Het
Pcdhga7	A	G	18: 37,716,916	T659A	probably damaging	Het
Pik3c2a	T	A	7: 116,388,086	K533N	probably damaging	Het
Pkd1l1	T	A	11: 8,929,402	Q933L		Het
Ppp4r3a	A	T	12: 101,053,511	M395K	possibly damaging	Het
Pramef6	C	A	4: 143,895,421	V455L	probably benign	Het
Ptpn20	A	G	14: 33,614,524	T107A	probably benign	Het
Scaf8	T	A	17: 3,177,625	D376E	unknown	Het
Scn11a	C	A	9: 119,815,265	C143F	probably damaging	Het
Sctr	G	A	1: 120,022,225	R48Q	probably benign	Het
Sec13	A	T	6: 113,735,136	Y79*	probably null	Het
Sez6	T	A	11: 77,962,865	I287N	probably damaging	Het
Slc52a3	T	A	2: 152,004,416	I99K	possibly damaging	Het
Slco4c1	T	G	1: 96,871,793	H106P	probably damaging	Het
Tada2b	A	G	5: 36,476,608	Y209H	probably damaging	Het
Tas1r2	T	A	4: 139,669,652	D796E	probably benign	Het
Tdrd12	A	T	7: 35,487,722	M581K		Het
Thnsl1	A	G	2: 21,212,458	E341G	probably damaging	Het
Tlk2	C	T	11: 105,184,244	R11*	probably null	Het
Tmco6	T	C	18: 36,739,343		probably null	Het
Trmt44	A	T	5: 35,564,303	H505Q	probably benign	Het
Trpc1	T	C	9: 95,708,275	M710V	probably benign	Het
Ttc21b	T	C	2: 66,210,173	E858G	possibly damaging	Het
Twsg1	C	T	17: 65,929,787	D83N	possibly damaging	Het
Umod	G	T	7: 119,466,073	Q578K	probably benign	Het
Vmn2r6	T	C	3: 64,556,774	N213S	probably benign	Het
Vmn2r88	G	A	14: 51,418,319	V662I		Het
Zfp414	C	A	17: 33,631,279	D217E	probably benign	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGGATGCATTGCAGGACTATC -3'
(R):5'- TCTTCACCTGAGCCTCAAAC -3'

Sequencing Primer
(F):5'- GCATTGCAGGACTATCAGTTTC -3'
(R):5'- TCAAACATCTCCACATTTATCTTGG -3'

Posted On

2019-06-26