Incidental Mutation 'R7265:Myo1c'
ID564885
Institutional Source Beutler Lab
Gene Symbol Myo1c
Ensembl Gene ENSMUSG00000017774
Gene Namemyosin IC
SynonymsC80397, myosin-Ibeta, myr2, mm1beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.717) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location75650504-75673910 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75669790 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 706 (I706T)
Ref Sequence ENSEMBL: ENSMUSP00000070388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069057] [ENSMUST00000102504] [ENSMUST00000102505] [ENSMUST00000108431]
PDB Structure
Crystal Structure of Myosin-1c tail in complex with Calmodulin [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069057
AA Change: I706T

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070388
Gene: ENSMUSG00000017774
AA Change: I706T

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102504
AA Change: I706T

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099562
Gene: ENSMUSG00000017774
AA Change: I706T

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102505
AA Change: I741T

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099563
Gene: ENSMUSG00000017774
AA Change: I741T

DomainStartEndE-ValueType
MYSc 40 732 N/A SMART
IQ 733 755 3.85e-3 SMART
IQ 756 778 2.09e-4 SMART
Blast:MYSc 786 815 6e-9 BLAST
low complexity region 839 850 N/A INTRINSIC
Pfam:Myosin_TH1 874 1052 2.9e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108431
AA Change: I722T

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104069
Gene: ENSMUSG00000017774
AA Change: I722T

DomainStartEndE-ValueType
MYSc 21 713 N/A SMART
IQ 714 736 3.85e-3 SMART
IQ 737 759 2.09e-4 SMART
Blast:MYSc 767 796 5e-9 BLAST
low complexity region 820 831 N/A INTRINSIC
Pfam:Myosin_TH1 854 1040 3.3e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the unconventional myosin protein family, which are actin-based molecular motors. The protein is found in the cytoplasm, and one isoform with a unique N-terminus is also found in the nucleus. The protein functions in intracellular vesicle transport to the plasma membrane. The nuclear isoform associates with RNA polymerase I and II and functions in transcription initiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in (Y61G) mutation that sensitizes to N6-modified ADP analogs display altered fast adaption in vestibular hair cells. Mice homozygous for a nuclear isoform-specifc knock-out allele exhibit minor changes in bone marrow density and red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Myo1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Myo1c APN 11 75672250 missense probably damaging 1.00
IGL02054:Myo1c APN 11 75661136 missense probably benign 0.30
IGL02115:Myo1c APN 11 75661591 missense probably damaging 0.99
IGL02375:Myo1c APN 11 75661574 missense probably benign 0.00
IGL02878:Myo1c APN 11 75669033 missense possibly damaging 0.93
IGL03008:Myo1c APN 11 75658414 missense probably benign 0.13
Sweeper UTSW 11 75670030 nonsense probably null
R0070:Myo1c UTSW 11 75660250 missense probably benign 0.39
R0070:Myo1c UTSW 11 75660250 missense probably benign 0.39
R0138:Myo1c UTSW 11 75661001 missense possibly damaging 0.92
R0200:Myo1c UTSW 11 75672182 missense probably benign 0.00
R0227:Myo1c UTSW 11 75658694 missense probably benign 0.34
R0257:Myo1c UTSW 11 75665516 critical splice acceptor site probably null
R0513:Myo1c UTSW 11 75665831 splice site probably null
R0587:Myo1c UTSW 11 75657790 missense probably damaging 1.00
R0667:Myo1c UTSW 11 75668512 missense probably damaging 1.00
R1469:Myo1c UTSW 11 75669961 missense probably damaging 1.00
R1469:Myo1c UTSW 11 75669961 missense probably damaging 1.00
R1793:Myo1c UTSW 11 75657589 missense probably damaging 0.98
R1922:Myo1c UTSW 11 75668229 missense probably benign
R2000:Myo1c UTSW 11 75670579 missense probably damaging 1.00
R3983:Myo1c UTSW 11 75661499 missense probably benign 0.05
R4583:Myo1c UTSW 11 75671862 missense possibly damaging 0.72
R4599:Myo1c UTSW 11 75668193 missense probably damaging 0.99
R4671:Myo1c UTSW 11 75670030 nonsense probably null
R4682:Myo1c UTSW 11 75670030 nonsense probably null
R4708:Myo1c UTSW 11 75670030 nonsense probably null
R4709:Myo1c UTSW 11 75670030 nonsense probably null
R4742:Myo1c UTSW 11 75670030 nonsense probably null
R4770:Myo1c UTSW 11 75660313 nonsense probably null
R4888:Myo1c UTSW 11 75669227 missense probably damaging 1.00
R4915:Myo1c UTSW 11 75656309 start codon destroyed probably null
R4934:Myo1c UTSW 11 75671850 missense probably damaging 1.00
R4971:Myo1c UTSW 11 75671588 missense probably damaging 1.00
R5319:Myo1c UTSW 11 75662026 missense possibly damaging 0.95
R5589:Myo1c UTSW 11 75657588 missense possibly damaging 0.74
R5624:Myo1c UTSW 11 75662635 missense probably damaging 0.99
R5756:Myo1c UTSW 11 75658414 missense probably benign 0.42
R5959:Myo1c UTSW 11 75657519 missense probably benign 0.37
R6160:Myo1c UTSW 11 75650742 missense probably benign 0.00
R6559:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6568:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6569:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6574:Myo1c UTSW 11 75656298 start gained probably benign
R6579:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6580:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6583:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6640:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6642:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6643:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6679:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6680:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6687:Myo1c UTSW 11 75672201 missense probably benign
R6695:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6696:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6700:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6712:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6713:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6715:Myo1c UTSW 11 75671635 missense probably benign 0.42
R7081:Myo1c UTSW 11 75660963 missense probably benign
R7397:Myo1c UTSW 11 75671242 missense probably benign 0.17
R7586:Myo1c UTSW 11 75657519 missense possibly damaging 0.77
R7714:Myo1c UTSW 11 75658693 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGTCATCCCAGTTGCC -3'
(R):5'- CTGTAGTTCCCACACACTGG -3'

Sequencing Primer
(F):5'- CAGTTGCCTCTGGACACAG -3'
(R):5'- ACTCACCGACGGATGGTCTG -3'
Posted On2019-06-26