Incidental Mutation 'R7265:Olfr202'
ID564897
Institutional Source Beutler Lab
Gene Symbol Olfr202
Ensembl Gene ENSMUSG00000048810
Gene Nameolfactory receptor 202
SynonymsMOR182-1, GA_x54KRFPKG5P-55498766-55497843
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59283516-59286793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59283924 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 191 (D191V)
Ref Sequence ENSEMBL: ENSMUSP00000144622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049859] [ENSMUST00000201687] [ENSMUST00000217485]
Predicted Effect probably damaging
Transcript: ENSMUST00000049859
AA Change: D191V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059496
Gene: ENSMUSG00000048810
AA Change: D191V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.9e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 296 1.9e-6 PFAM
Pfam:7tm_1 41 290 1.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201687
AA Change: D191V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144622
Gene: ENSMUSG00000048810
AA Change: D191V

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.4e-46 PFAM
Pfam:7tm_1 40 289 1.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217485
AA Change: D191V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Olfr202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Olfr202 APN 16 59284221 missense probably damaging 0.99
IGL02439:Olfr202 APN 16 59284455 missense probably damaging 1.00
IGL02798:Olfr202 APN 16 59284115 nonsense probably null
IGL03075:Olfr202 APN 16 59283928 missense possibly damaging 0.87
IGL03186:Olfr202 APN 16 59283903 missense probably damaging 0.98
R0270:Olfr202 UTSW 16 59283753 missense probably damaging 1.00
R0631:Olfr202 UTSW 16 59284207 missense possibly damaging 0.60
R1441:Olfr202 UTSW 16 59283865 missense probably benign 0.00
R1546:Olfr202 UTSW 16 59284003 missense probably damaging 1.00
R3403:Olfr202 UTSW 16 59284112 missense probably benign 0.09
R4790:Olfr202 UTSW 16 59284458 missense probably damaging 0.99
R4960:Olfr202 UTSW 16 59283985 missense probably benign 0.23
R5369:Olfr202 UTSW 16 59284380 missense probably damaging 0.97
R5419:Olfr202 UTSW 16 59284341 missense probably damaging 0.99
R5646:Olfr202 UTSW 16 59283979 missense probably benign 0.00
R6048:Olfr202 UTSW 16 59283979 missense probably benign 0.00
R6732:Olfr202 UTSW 16 59283951 missense probably benign 0.16
R6994:Olfr202 UTSW 16 59284090 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TATCTTCAGCTGGCTCAGACC -3'
(R):5'- GGTGATGTCCAACAAGCTCTG -3'

Sequencing Primer
(F):5'- TGGCTCAGACCCAGGAAG -3'
(R):5'- TGATGTCCAACAAGCTCTGTACTCAG -3'
Posted On2019-06-26