Incidental Mutation 'R7265:Pcdhb20'
ID564904
Institutional Source Beutler Lab
Gene Symbol Pcdhb20
Ensembl Gene ENSMUSG00000046191
Gene Nameprotocadherin beta 20
SynonymsPcdhbT, Pcdhb14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37504264-37507822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37505563 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 381 (I381F)
Ref Sequence ENSEMBL: ENSMUSP00000137038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052179] [ENSMUST00000059571] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052179
AA Change: I381F

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137038
Gene: ENSMUSG00000046191
AA Change: I381F

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 8.3e-36 PFAM
low complexity region 136 148 N/A INTRINSIC
CA 155 240 1.41e-19 SMART
CA 264 345 2.91e-21 SMART
CA 368 449 1.12e-22 SMART
CA 473 559 3.41e-27 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 769 7.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059571
SMART Domains Protein: ENSMUSP00000053326
Gene: ENSMUSG00000043313

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 45 131 4.8e-1 SMART
CA 155 240 6.58e-20 SMART
CA 264 345 1.03e-21 SMART
CA 368 449 4.21e-18 SMART
CA 473 559 3.36e-26 SMART
CA 589 670 6.69e-12 SMART
Pfam:Cadherin_C_2 686 769 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Pcdhb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Pcdhb20 APN 18 37504685 missense possibly damaging 0.87
IGL01373:Pcdhb20 APN 18 37506568 missense probably benign 0.10
IGL01556:Pcdhb20 APN 18 37504799 missense possibly damaging 0.88
IGL01621:Pcdhb20 APN 18 37504807 missense possibly damaging 0.49
IGL01768:Pcdhb20 APN 18 37506715 missense possibly damaging 0.80
IGL01859:Pcdhb20 APN 18 37504563 missense probably damaging 0.98
IGL02492:Pcdhb20 APN 18 37506400 missense probably benign 0.43
IGL03057:Pcdhb20 APN 18 37504798 missense possibly damaging 0.74
IGL02991:Pcdhb20 UTSW 18 37506211 missense probably damaging 1.00
R0799:Pcdhb20 UTSW 18 37505885 missense probably damaging 1.00
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R2012:Pcdhb20 UTSW 18 37505074 missense probably damaging 0.99
R2079:Pcdhb20 UTSW 18 37505171 missense probably benign 0.07
R2350:Pcdhb20 UTSW 18 37504510 missense probably benign 0.01
R2363:Pcdhb20 UTSW 18 37505672 missense probably damaging 1.00
R2364:Pcdhb20 UTSW 18 37505938 missense probably damaging 1.00
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R4060:Pcdhb20 UTSW 18 37506164 missense probably damaging 1.00
R4609:Pcdhb20 UTSW 18 37505796 missense probably benign 0.02
R4750:Pcdhb20 UTSW 18 37506131 missense possibly damaging 0.48
R4897:Pcdhb20 UTSW 18 37506245 missense possibly damaging 0.70
R4970:Pcdhb20 UTSW 18 37506771 missense probably benign 0.00
R5098:Pcdhb20 UTSW 18 37504805 missense probably damaging 1.00
R5616:Pcdhb20 UTSW 18 37504532 missense probably damaging 0.97
R5890:Pcdhb20 UTSW 18 37505233 missense probably benign 0.00
R6225:Pcdhb20 UTSW 18 37504994 missense probably damaging 1.00
R6248:Pcdhb20 UTSW 18 37506232 missense probably damaging 0.99
R6419:Pcdhb20 UTSW 18 37505555 missense probably damaging 1.00
R6814:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R6821:Pcdhb20 UTSW 18 37506122 missense probably damaging 1.00
R6824:Pcdhb20 UTSW 18 37505699 missense probably benign 0.06
R6872:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R7040:Pcdhb20 UTSW 18 37504717 missense probably benign 0.00
R7145:Pcdhb20 UTSW 18 37505089 missense probably damaging 1.00
R7165:Pcdhb20 UTSW 18 37505070 missense probably damaging 1.00
R7215:Pcdhb20 UTSW 18 37505386 missense probably benign 0.24
R7372:Pcdhb20 UTSW 18 37506787 missense probably benign 0.00
R7402:Pcdhb20 UTSW 18 37504952 missense probably benign 0.05
R7718:Pcdhb20 UTSW 18 37505651 missense probably damaging 1.00
R7794:Pcdhb20 UTSW 18 37504432 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGGTCTTTCTGCAAAATGC -3'
(R):5'- CACTGATGGTGCCTATGTGC -3'

Sequencing Primer
(F):5'- GCAAAATGCACTCTTTCGGTTAAAG -3'
(R):5'- GGCATTGTCATTGATGTCAGATACC -3'
Posted On2019-06-26