Incidental Mutation 'R7266:Plekhm2'
ID564921
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms2310034J19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7266 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141625734-141664899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 141642459 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 75 (E75A)
Ref Sequence ENSEMBL: ENSMUSP00000030751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030751
AA Change: E75A

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: E75A

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000084203
AA Change: E75A

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: E75A

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T A 8: 24,667,623 I104F probably benign Het
Adgrg7 C T 16: 56,770,311 V166I probably benign Het
Agfg1 G T 1: 82,882,245 V278L probably benign Het
Alpk3 A G 7: 81,092,580 E715G possibly damaging Het
Ap2m1 A G 16: 20,543,345 Y401C probably damaging Het
Arhgef28 C T 13: 97,965,452 S838N probably benign Het
Ash2l A T 8: 25,827,205 Y373* probably null Het
Best2 C T 8: 85,007,764 V442I probably benign Het
Col4a2 T C 8: 11,425,542 probably null Het
Fat2 T A 11: 55,285,030 D1619V probably damaging Het
Fer1l6 A T 15: 58,627,597 N1272I probably benign Het
Gcc1 T A 6: 28,417,996 *779C probably null Het
Gm12216 G A 11: 53,859,251 probably benign Het
Gm17657 C A 17: 29,519,373 V140L probably benign Het
Gm7102 A G 19: 61,175,535 V154A possibly damaging Het
Grm2 C T 9: 106,647,171 V311I Het
Immt T A 6: 71,874,705 D683E probably benign Het
Itga8 T G 2: 12,232,901 D336A probably damaging Het
Jhy T C 9: 40,961,157 T19A probably benign Het
Kcnq2 T C 2: 181,135,092 M1V probably null Het
Kctd17 A T 15: 78,433,014 I117F probably damaging Het
Lrp6 T C 6: 134,507,401 T420A probably damaging Het
Manba T C 3: 135,517,912 S187P probably damaging Het
Mef2b A T 8: 70,164,288 D13V probably damaging Het
Mical2 T C 7: 112,303,756 F145L probably damaging Het
Mphosph8 T A 14: 56,685,040 D551E possibly damaging Het
Myo10 C G 15: 25,782,981 R1170G probably damaging Het
Myo16 A C 8: 10,272,687 Q39P unknown Het
Myo1f A G 17: 33,601,694 E837G probably benign Het
Nell2 T A 15: 95,435,393 I128F possibly damaging Het
Olfr1357 A G 10: 78,612,614 V9A probably benign Het
Pcdh15 A T 10: 74,379,390 R659* probably null Het
Pcdhga1 A G 18: 37,839,975 Q881R possibly damaging Het
Prc1 A G 7: 80,307,657 K357E possibly damaging Het
Pxk T A 14: 8,146,220 C377S probably benign Het
Ralgapa2 T C 2: 146,334,568 E1696G probably damaging Het
Rbbp6 T A 7: 123,001,367 S1532R unknown Het
Scn5a G T 9: 119,562,560 A22E probably benign Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Siae T C 9: 37,623,013 V115A probably damaging Het
Slc16a6 A G 11: 109,453,281 C563R probably benign Het
Sntg1 A C 1: 8,682,019 V58G possibly damaging Het
Snx11 C T 11: 96,773,159 V36M probably damaging Het
Stk3 C A 15: 34,959,036 S330I probably benign Het
Synpo A G 18: 60,629,559 F92S probably benign Het
Tle1 A G 4: 72,139,687 probably null Het
Tmem117 A G 15: 94,931,803 D173G possibly damaging Het
Tmprss5 T C 9: 49,114,541 W338R probably benign Het
Tnfrsf19 T C 14: 60,974,698 T168A possibly damaging Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Trim56 G T 5: 137,114,243 Q140K probably damaging Het
Ttn C T 2: 76,732,574 V28679M probably damaging Het
Ubxn8 G A 8: 33,623,203 R208C probably damaging Het
Vmn2r72 G T 7: 85,738,274 S694* probably null Het
Wdr38 T A 2: 39,000,264 W137R probably damaging Het
Zdhhc6 G T 19: 55,304,500 N271K probably damaging Het
Zfyve9 A G 4: 108,718,547 S446P possibly damaging Het
Zmynd8 T C 2: 165,807,572 Q867R possibly damaging Het
Zswim3 T C 2: 164,820,482 I294T probably benign Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141642645 splice site probably null
IGL01388:Plekhm2 APN 4 141642001 missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141642426 missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141630029 missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141629585 missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141637419 splice site probably benign
IGL02075:Plekhm2 APN 4 141628306 missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141642723 missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141642019 missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141634272 missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141642524 splice site probably benign
IGL02828:Plekhm2 APN 4 141629630 missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141634347 missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0639:Plekhm2 UTSW 4 141642070 missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141628125 missense probably damaging 0.97
R0968:Plekhm2 UTSW 4 141629932 missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141627984 missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141627854 missense possibly damaging 0.75
R1802:Plekhm2 UTSW 4 141634347 missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141642439 missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141632374 missense probably benign
R2261:Plekhm2 UTSW 4 141642732 missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141641990 splice site probably benign
R3922:Plekhm2 UTSW 4 141629532 missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141631857 missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141642005 missense possibly damaging 0.91
R4814:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141628100 missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141628289 missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141639693 missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141632341 nonsense probably null
R6367:Plekhm2 UTSW 4 141639705 missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141629532 missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141632033 missense probably damaging 1.00
R7399:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R7573:Plekhm2 UTSW 4 141631347 missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141628046 missense probably damaging 0.96
R7920:Plekhm2 UTSW 4 141632121 missense probably damaging 1.00
R8417:Plekhm2 UTSW 4 141627825 missense probably benign 0.04
R8462:Plekhm2 UTSW 4 141639819 missense probably damaging 1.00
R8504:Plekhm2 UTSW 4 141642453 missense probably damaging 1.00
T0722:Plekhm2 UTSW 4 141631981 small deletion probably benign
T0975:Plekhm2 UTSW 4 141631981 small deletion probably benign
X0024:Plekhm2 UTSW 4 141628041 missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141629085 missense possibly damaging 0.77
Z1177:Plekhm2 UTSW 4 141639822 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACAAACTGTCACATGCAGGGG -3'
(R):5'- TGTACGGGTGAGTTCAGTCC -3'

Sequencing Primer
(F):5'- ATGAGGCTCTGCGGAAGGC -3'
(R):5'- GGTGAGTTCAGTCCCCTCC -3'
Posted On2019-06-26