Mutagenetix > Incidental Mutations

Incidental Mutation 'R7266:Plekhm2'

564921

Institutional Source

Beutler Lab

Gene Symbol

Plekhm2

Ensembl Gene

ENSMUSG00000028917

Gene Name

pleckstrin homology domain containing, family M (with RUN domain) member 2

Synonyms

2310034J19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7266 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141625734-141664899 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 141642459 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 75 (E75A)

Ref Sequence

ENSEMBL: ENSMUSP00000030751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030751
AA Change: E75A

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: E75A

Domain	Start	End	E-Value	Type
RUN	93	156	3.18e-21	SMART
low complexity region	230	246	N/A	INTRINSIC
low complexity region	295	307	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
low complexity region	485	495	N/A	INTRINSIC
low complexity region	505	538	N/A	INTRINSIC
Blast:PH	596	656	7e-31	BLAST
PH	766	869	2.43e-12	SMART
Blast:PH	879	960	6e-9	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084203
AA Change: E75A

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: E75A

Domain	Start	End	E-Value	Type
RUN	93	156	3.18e-21	SMART
low complexity region	250	266	N/A	INTRINSIC
low complexity region	315	327	N/A	INTRINSIC
low complexity region	479	489	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
low complexity region	525	558	N/A	INTRINSIC
Blast:PH	616	676	7e-31	BLAST
PH	786	889	2.43e-12	SMART
Blast:PH	899	980	6e-9	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	T	A	8: 24,667,623	I104F	probably benign	Het
Adgrg7	C	T	16: 56,770,311	V166I	probably benign	Het
Agfg1	G	T	1: 82,882,245	V278L	probably benign	Het
Alpk3	A	G	7: 81,092,580	E715G	possibly damaging	Het
Ap2m1	A	G	16: 20,543,345	Y401C	probably damaging	Het
Arhgef28	C	T	13: 97,965,452	S838N	probably benign	Het
Ash2l	A	T	8: 25,827,205	Y373*	probably null	Het
Best2	C	T	8: 85,007,764	V442I	probably benign	Het
Col4a2	T	C	8: 11,425,542		probably null	Het
Fat2	T	A	11: 55,285,030	D1619V	probably damaging	Het
Fer1l6	A	T	15: 58,627,597	N1272I	probably benign	Het
Gcc1	T	A	6: 28,417,996	*779C	probably null	Het
Gm12216	G	A	11: 53,859,251		probably benign	Het
Gm17657	C	A	17: 29,519,373	V140L	probably benign	Het
Gm7102	A	G	19: 61,175,535	V154A	possibly damaging	Het
Grm2	C	T	9: 106,647,171	V311I		Het
Immt	T	A	6: 71,874,705	D683E	probably benign	Het
Itga8	T	G	2: 12,232,901	D336A	probably damaging	Het
Jhy	T	C	9: 40,961,157	T19A	probably benign	Het
Kcnq2	T	C	2: 181,135,092	M1V	probably null	Het
Kctd17	A	T	15: 78,433,014	I117F	probably damaging	Het
Lrp6	T	C	6: 134,507,401	T420A	probably damaging	Het
Manba	T	C	3: 135,517,912	S187P	probably damaging	Het
Mef2b	A	T	8: 70,164,288	D13V	probably damaging	Het
Mical2	T	C	7: 112,303,756	F145L	probably damaging	Het
Mphosph8	T	A	14: 56,685,040	D551E	possibly damaging	Het
Myo10	C	G	15: 25,782,981	R1170G	probably damaging	Het
Myo16	A	C	8: 10,272,687	Q39P	unknown	Het
Myo1f	A	G	17: 33,601,694	E837G	probably benign	Het
Nell2	T	A	15: 95,435,393	I128F	possibly damaging	Het
Olfr1357	A	G	10: 78,612,614	V9A	probably benign	Het
Pcdh15	A	T	10: 74,379,390	R659*	probably null	Het
Pcdhga1	A	G	18: 37,839,975	Q881R	possibly damaging	Het
Prc1	A	G	7: 80,307,657	K357E	possibly damaging	Het
Pxk	T	A	14: 8,146,220	C377S	probably benign	Het
Ralgapa2	T	C	2: 146,334,568	E1696G	probably damaging	Het
Rbbp6	T	A	7: 123,001,367	S1532R	unknown	Het
Scn5a	G	T	9: 119,562,560	A22E	probably benign	Het
Sctr	G	A	1: 120,022,225	R48Q	probably benign	Het
Siae	T	C	9: 37,623,013	V115A	probably damaging	Het
Slc16a6	A	G	11: 109,453,281	C563R	probably benign	Het
Sntg1	A	C	1: 8,682,019	V58G	possibly damaging	Het
Snx11	C	T	11: 96,773,159	V36M	probably damaging	Het
Stk3	C	A	15: 34,959,036	S330I	probably benign	Het
Synpo	A	G	18: 60,629,559	F92S	probably benign	Het
Tle1	A	G	4: 72,139,687		probably null	Het
Tmem117	A	G	15: 94,931,803	D173G	possibly damaging	Het
Tmprss5	T	C	9: 49,114,541	W338R	probably benign	Het
Tnfrsf19	T	C	14: 60,974,698	T168A	possibly damaging	Het
Trhde	C	T	10: 114,800,871	G144S	possibly damaging	Het
Trim56	G	T	5: 137,114,243	Q140K	probably damaging	Het
Ttn	C	T	2: 76,732,574	V28679M	probably damaging	Het
Ubxn8	G	A	8: 33,623,203	R208C	probably damaging	Het
Vmn2r72	G	T	7: 85,738,274	S694*	probably null	Het
Wdr38	T	A	2: 39,000,264	W137R	probably damaging	Het
Zdhhc6	G	T	19: 55,304,500	N271K	probably damaging	Het
Zfyve9	A	G	4: 108,718,547	S446P	possibly damaging	Het
Zmynd8	T	C	2: 165,807,572	Q867R	possibly damaging	Het
Zswim3	T	C	2: 164,820,482	I294T	probably benign	Het

Other mutations in Plekhm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Plekhm2	APN	4	141642645	splice site	probably null
IGL01388:Plekhm2	APN	4	141642001	missense	probably damaging	1.00
IGL01392:Plekhm2	APN	4	141642426	missense	probably damaging	0.98
IGL01482:Plekhm2	APN	4	141630029	missense	probably damaging	0.98
IGL01828:Plekhm2	APN	4	141629585	missense	probably benign	0.11
IGL02010:Plekhm2	APN	4	141637419	splice site	probably benign
IGL02075:Plekhm2	APN	4	141628306	missense	probably benign	0.38
IGL02381:Plekhm2	APN	4	141642723	missense	possibly damaging	0.95
IGL02543:Plekhm2	APN	4	141642019	missense	probably benign	0.02
IGL02747:Plekhm2	APN	4	141634272	missense	possibly damaging	0.55
IGL02802:Plekhm2	APN	4	141642524	splice site	probably benign
IGL02828:Plekhm2	APN	4	141629630	missense	probably damaging	1.00
IGL03286:Plekhm2	APN	4	141634347	missense	possibly damaging	0.95
R0008:Plekhm2	UTSW	4	141642393	splice site	probably benign
R0008:Plekhm2	UTSW	4	141642393	splice site	probably benign
R0639:Plekhm2	UTSW	4	141642070	missense	probably damaging	1.00
R0682:Plekhm2	UTSW	4	141628125	missense	probably damaging	0.97
R0968:Plekhm2	UTSW	4	141629932	missense	probably benign	0.01
R1109:Plekhm2	UTSW	4	141627984	missense	probably benign	0.31
R1475:Plekhm2	UTSW	4	141627854	missense	possibly damaging	0.75
R1802:Plekhm2	UTSW	4	141634347	missense	probably benign	0.03
R1813:Plekhm2	UTSW	4	141642439	missense	possibly damaging	0.93
R1844:Plekhm2	UTSW	4	141632374	missense	probably benign
R2261:Plekhm2	UTSW	4	141642732	missense	probably damaging	0.98
R3889:Plekhm2	UTSW	4	141641990	splice site	probably benign
R3922:Plekhm2	UTSW	4	141629532	missense	probably benign	0.01
R4324:Plekhm2	UTSW	4	141631857	missense	possibly damaging	0.86
R4758:Plekhm2	UTSW	4	141642005	missense	possibly damaging	0.91
R4814:Plekhm2	UTSW	4	141627839	missense	probably benign	0.00
R4983:Plekhm2	UTSW	4	141634376	missense	probably damaging	1.00
R5468:Plekhm2	UTSW	4	141628100	missense	probably damaging	1.00
R5691:Plekhm2	UTSW	4	141628289	missense	possibly damaging	0.96
R5877:Plekhm2	UTSW	4	141639693	missense	probably damaging	0.98
R6268:Plekhm2	UTSW	4	141632341	nonsense	probably null
R6367:Plekhm2	UTSW	4	141639705	missense	probably damaging	0.97
R6371:Plekhm2	UTSW	4	141629532	missense	possibly damaging	0.94
R6489:Plekhm2	UTSW	4	141632033	missense	probably damaging	1.00
R7399:Plekhm2	UTSW	4	141634376	missense	probably damaging	1.00
R7573:Plekhm2	UTSW	4	141631347	missense	probably benign	0.02
R7742:Plekhm2	UTSW	4	141627839	missense	probably benign	0.00
R7864:Plekhm2	UTSW	4	141628046	missense	probably damaging	0.96
R7920:Plekhm2	UTSW	4	141632121	missense	probably damaging	1.00
R8417:Plekhm2	UTSW	4	141627825	missense	probably benign	0.04
R8462:Plekhm2	UTSW	4	141639819	missense	probably damaging	1.00
R8504:Plekhm2	UTSW	4	141642453	missense	probably damaging	1.00
T0722:Plekhm2	UTSW	4	141631981	small deletion	probably benign
T0975:Plekhm2	UTSW	4	141631981	small deletion	probably benign
X0024:Plekhm2	UTSW	4	141628041	missense	probably damaging	1.00
Z1177:Plekhm2	UTSW	4	141629085	missense	possibly damaging	0.77
Z1177:Plekhm2	UTSW	4	141639822	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- ACAAACTGTCACATGCAGGGG -3'
(R):5'- TGTACGGGTGAGTTCAGTCC -3'

Sequencing Primer
(F):5'- ATGAGGCTCTGCGGAAGGC -3'
(R):5'- GGTGAGTTCAGTCCCCTCC -3'

Posted On

2019-06-26