Incidental Mutation 'R0583:Olfr1085'
ID56493
Institutional Source Beutler Lab
Gene Symbol Olfr1085
Ensembl Gene ENSMUSG00000075176
Gene Nameolfactory receptor 1085
SynonymsGA_x6K02T2Q125-48147264-48146323, MOR191-1
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0583 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86653665-86662019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86658360 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 33 (I33F)
Ref Sequence ENSEMBL: ENSMUSP00000150955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099879] [ENSMUST00000213279] [ENSMUST00000214566]
Predicted Effect probably benign
Transcript: ENSMUST00000099879
AA Change: I33F

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097464
Gene: ENSMUSG00000075176
AA Change: I33F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.6e-49 PFAM
Pfam:7tm_1 41 290 1.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213279
AA Change: I33F

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000214566
AA Change: I33F

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Olfr1085
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Olfr1085 APN 2 86657726 missense probably damaging 0.98
IGL01137:Olfr1085 APN 2 86657711 missense possibly damaging 0.92
IGL01329:Olfr1085 APN 2 86658207 missense probably benign 0.31
IGL01398:Olfr1085 APN 2 86657688 missense probably damaging 1.00
IGL02248:Olfr1085 APN 2 86657717 missense probably damaging 1.00
IGL02699:Olfr1085 APN 2 86658347 missense probably benign 0.34
IGL02818:Olfr1085 APN 2 86657784 missense probably damaging 1.00
IGL03095:Olfr1085 APN 2 86658431 missense possibly damaging 0.50
IGL03218:Olfr1085 APN 2 86658359 missense probably benign 0.32
R0121:Olfr1085 UTSW 2 86657819 missense probably benign 0.42
R0546:Olfr1085 UTSW 2 86657891 missense possibly damaging 0.91
R0980:Olfr1085 UTSW 2 86657865 missense probably benign 0.39
R2067:Olfr1085 UTSW 2 86658437 missense probably damaging 1.00
R2111:Olfr1085 UTSW 2 86658437 missense probably damaging 1.00
R3760:Olfr1085 UTSW 2 86657888 missense possibly damaging 0.91
R4530:Olfr1085 UTSW 2 86657561 missense probably benign 0.00
R4809:Olfr1085 UTSW 2 86657685 missense possibly damaging 0.95
R5940:Olfr1085 UTSW 2 86658050 missense probably damaging 0.98
R6027:Olfr1085 UTSW 2 86657804 missense probably damaging 1.00
R6417:Olfr1085 UTSW 2 86658166 nonsense probably null
R6420:Olfr1085 UTSW 2 86658166 nonsense probably null
R6619:Olfr1085 UTSW 2 86658062 missense probably damaging 1.00
R6762:Olfr1085 UTSW 2 86657844 missense probably benign 0.22
R6946:Olfr1085 UTSW 2 86657588 missense probably damaging 1.00
R7673:Olfr1085 UTSW 2 86657726 missense probably damaging 1.00
R7718:Olfr1085 UTSW 2 86658029 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGATATATGGGACCGCCACAAGTACC -3'
(R):5'- AGAAACAAATCCCTGTTACTGCCTCTG -3'

Sequencing Primer
(F):5'- GGAGACTGAATTATGCTCTGCAAC -3'
(R):5'- GACAATGTCTCAAgtttttgtttttg -3'
Posted On2013-07-11