Incidental Mutation 'R7266:Ubxn8'
ID564935
Institutional Source Beutler Lab
Gene Symbol Ubxn8
Ensembl Gene ENSMUSG00000052906
Gene NameUBX domain protein 8
SynonymsRep8h, Rep-8, D0H8S2298E, Ubxd6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R7266 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location33619586-33641967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33623203 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 208 (R208C)
Ref Sequence ENSEMBL: ENSMUSP00000092992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009774] [ENSMUST00000095349]
Predicted Effect probably benign
Transcript: ENSMUST00000009774
SMART Domains Protein: ENSMUSP00000009774
Gene: ENSMUSG00000009630

DomainStartEndE-ValueType
PP2Ac 23 293 2.48e-156 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095349
AA Change: R208C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092992
Gene: ENSMUSG00000052906
AA Change: R208C

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
Pfam:UBX 192 271 3.8e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] p97 or VCP (valosin-containing protein) is a versatile ATPase complex, and many cofactors are required for the p97 functional diversity. This gene encodes one of the p97 cofactors. This cofactor is a transmembrane protein and localized in the endoplasmic reticulum (ER) membrane. It tethers p97 to the ER membrane via its UBX domain. The association of this cofactor with p97 facilitates efficient ER-associated degradation of misfolded proteins. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T A 8: 24,667,623 I104F probably benign Het
Adgrg7 C T 16: 56,770,311 V166I probably benign Het
Agfg1 G T 1: 82,882,245 V278L probably benign Het
Alpk3 A G 7: 81,092,580 E715G possibly damaging Het
Ap2m1 A G 16: 20,543,345 Y401C probably damaging Het
Arhgef28 C T 13: 97,965,452 S838N probably benign Het
Ash2l A T 8: 25,827,205 Y373* probably null Het
Best2 C T 8: 85,007,764 V442I probably benign Het
Col4a2 T C 8: 11,425,542 probably null Het
Fat2 T A 11: 55,285,030 D1619V probably damaging Het
Fer1l6 A T 15: 58,627,597 N1272I probably benign Het
Gcc1 T A 6: 28,417,996 *779C probably null Het
Gm12216 G A 11: 53,859,251 probably benign Het
Gm17657 C A 17: 29,519,373 V140L probably benign Het
Gm7102 A G 19: 61,175,535 V154A possibly damaging Het
Grm2 C T 9: 106,647,171 V311I Het
Immt T A 6: 71,874,705 D683E probably benign Het
Itga8 T G 2: 12,232,901 D336A probably damaging Het
Jhy T C 9: 40,961,157 T19A probably benign Het
Kcnq2 T C 2: 181,135,092 M1V probably null Het
Kctd17 A T 15: 78,433,014 I117F probably damaging Het
Lrp6 T C 6: 134,507,401 T420A probably damaging Het
Manba T C 3: 135,517,912 S187P probably damaging Het
Mef2b A T 8: 70,164,288 D13V probably damaging Het
Mical2 T C 7: 112,303,756 F145L probably damaging Het
Mphosph8 T A 14: 56,685,040 D551E possibly damaging Het
Myo10 C G 15: 25,782,981 R1170G probably damaging Het
Myo16 A C 8: 10,272,687 Q39P unknown Het
Myo1f A G 17: 33,601,694 E837G probably benign Het
Nell2 T A 15: 95,435,393 I128F possibly damaging Het
Olfr1357 A G 10: 78,612,614 V9A probably benign Het
Pcdh15 A T 10: 74,379,390 R659* probably null Het
Pcdhga1 A G 18: 37,839,975 Q881R possibly damaging Het
Plekhm2 T G 4: 141,642,459 E75A possibly damaging Het
Prc1 A G 7: 80,307,657 K357E possibly damaging Het
Pxk T A 14: 8,146,220 C377S probably benign Het
Ralgapa2 T C 2: 146,334,568 E1696G probably damaging Het
Rbbp6 T A 7: 123,001,367 S1532R unknown Het
Scn5a G T 9: 119,562,560 A22E probably benign Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Siae T C 9: 37,623,013 V115A probably damaging Het
Slc16a6 A G 11: 109,453,281 C563R probably benign Het
Sntg1 A C 1: 8,682,019 V58G possibly damaging Het
Snx11 C T 11: 96,773,159 V36M probably damaging Het
Stk3 C A 15: 34,959,036 S330I probably benign Het
Synpo A G 18: 60,629,559 F92S probably benign Het
Tle1 A G 4: 72,139,687 probably null Het
Tmem117 A G 15: 94,931,803 D173G possibly damaging Het
Tmprss5 T C 9: 49,114,541 W338R probably benign Het
Tnfrsf19 T C 14: 60,974,698 T168A possibly damaging Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Trim56 G T 5: 137,114,243 Q140K probably damaging Het
Ttn C T 2: 76,732,574 V28679M probably damaging Het
Vmn2r72 G T 7: 85,738,274 S694* probably null Het
Wdr38 T A 2: 39,000,264 W137R probably damaging Het
Zdhhc6 G T 19: 55,304,500 N271K probably damaging Het
Zfyve9 A G 4: 108,718,547 S446P possibly damaging Het
Zmynd8 T C 2: 165,807,572 Q867R possibly damaging Het
Zswim3 T C 2: 164,820,482 I294T probably benign Het
Other mutations in Ubxn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ubxn8 APN 8 33635305 missense probably benign 0.12
IGL01588:Ubxn8 APN 8 33621559 missense probably damaging 1.00
IGL01769:Ubxn8 APN 8 33629378 splice site probably benign
IGL02074:Ubxn8 APN 8 33623178 missense possibly damaging 0.77
PIT4468001:Ubxn8 UTSW 8 33621541 missense probably benign 0.10
R0098:Ubxn8 UTSW 8 33635365 splice site probably benign
R0098:Ubxn8 UTSW 8 33635365 splice site probably benign
R1167:Ubxn8 UTSW 8 33641901 missense probably damaging 0.97
R5203:Ubxn8 UTSW 8 33633611 missense probably damaging 0.98
R5299:Ubxn8 UTSW 8 33641919 missense possibly damaging 0.66
R6694:Ubxn8 UTSW 8 33621544 missense possibly damaging 0.59
R7526:Ubxn8 UTSW 8 33633607 missense probably benign 0.20
R8018:Ubxn8 UTSW 8 33623215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTCAGTCTGCAATGC -3'
(R):5'- TAGAGTTCCCATCTGGACTTCTG -3'

Sequencing Primer
(F):5'- CAATGCAGAACCTTCACATTGTCTG -3'
(R):5'- GGTGACCACTGTAGCTTACG -3'
Posted On2019-06-26