Incidental Mutation 'R7266:Tmprss5'
ID564940
Institutional Source Beutler Lab
Gene Symbol Tmprss5
Ensembl Gene ENSMUSG00000032268
Gene Nametransmembrane protease, serine 5 (spinesin)
Synonymsspinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7266 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location49081260-49117587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49114541 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 338 (W338R)
Ref Sequence ENSEMBL: ENSMUSP00000132181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070390] [ENSMUST00000165088] [ENSMUST00000166272] [ENSMUST00000167095] [ENSMUST00000170246]
Predicted Effect probably benign
Transcript: ENSMUST00000070390
AA Change: W328R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064527
Gene: ENSMUSG00000032268
AA Change: W328R

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Pfam:SRCR_2 106 203 4.2e-38 PFAM
Tryp_SPc 207 438 1.28e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165088
AA Change: W338R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132181
Gene: ENSMUSG00000032268
AA Change: W338R

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:SRCR_2 116 213 2.9e-38 PFAM
Tryp_SPc 217 448 1.28e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166272
SMART Domains Protein: ENSMUSP00000130069
Gene: ENSMUSG00000032268

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167095
AA Change: W264R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131650
Gene: ENSMUSG00000032268
AA Change: W264R

DomainStartEndE-ValueType
Pfam:SRCR_2 42 139 1.1e-38 PFAM
Tryp_SPc 143 374 1.28e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170246
AA Change: W322R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129482
Gene: ENSMUSG00000032268
AA Change: W322R

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Pfam:SRCR_2 100 197 1.4e-38 PFAM
Tryp_SPc 201 432 1.28e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170426
SMART Domains Protein: ENSMUSP00000128662
Gene: ENSMUSG00000032268

DomainStartEndE-ValueType
Pfam:SRCR_2 7 84 3.4e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. Serine proteases are known to be involved in many physiological and pathological processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T A 8: 24,667,623 I104F probably benign Het
Adgrg7 C T 16: 56,770,311 V166I probably benign Het
Agfg1 G T 1: 82,882,245 V278L probably benign Het
Alpk3 A G 7: 81,092,580 E715G possibly damaging Het
Ap2m1 A G 16: 20,543,345 Y401C probably damaging Het
Arhgef28 C T 13: 97,965,452 S838N probably benign Het
Ash2l A T 8: 25,827,205 Y373* probably null Het
Best2 C T 8: 85,007,764 V442I probably benign Het
Col4a2 T C 8: 11,425,542 probably null Het
Fat2 T A 11: 55,285,030 D1619V probably damaging Het
Fer1l6 A T 15: 58,627,597 N1272I probably benign Het
Gcc1 T A 6: 28,417,996 *779C probably null Het
Gm12216 G A 11: 53,859,251 probably benign Het
Gm17657 C A 17: 29,519,373 V140L probably benign Het
Gm7102 A G 19: 61,175,535 V154A possibly damaging Het
Grm2 C T 9: 106,647,171 V311I Het
Immt T A 6: 71,874,705 D683E probably benign Het
Itga8 T G 2: 12,232,901 D336A probably damaging Het
Jhy T C 9: 40,961,157 T19A probably benign Het
Kcnq2 T C 2: 181,135,092 M1V probably null Het
Kctd17 A T 15: 78,433,014 I117F probably damaging Het
Lrp6 T C 6: 134,507,401 T420A probably damaging Het
Manba T C 3: 135,517,912 S187P probably damaging Het
Mef2b A T 8: 70,164,288 D13V probably damaging Het
Mical2 T C 7: 112,303,756 F145L probably damaging Het
Mphosph8 T A 14: 56,685,040 D551E possibly damaging Het
Myo10 C G 15: 25,782,981 R1170G probably damaging Het
Myo16 A C 8: 10,272,687 Q39P unknown Het
Myo1f A G 17: 33,601,694 E837G probably benign Het
Nell2 T A 15: 95,435,393 I128F possibly damaging Het
Olfr1357 A G 10: 78,612,614 V9A probably benign Het
Pcdh15 A T 10: 74,379,390 R659* probably null Het
Pcdhga1 A G 18: 37,839,975 Q881R possibly damaging Het
Plekhm2 T G 4: 141,642,459 E75A possibly damaging Het
Prc1 A G 7: 80,307,657 K357E possibly damaging Het
Pxk T A 14: 8,146,220 C377S probably benign Het
Ralgapa2 T C 2: 146,334,568 E1696G probably damaging Het
Rbbp6 T A 7: 123,001,367 S1532R unknown Het
Scn5a G T 9: 119,562,560 A22E probably benign Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Siae T C 9: 37,623,013 V115A probably damaging Het
Slc16a6 A G 11: 109,453,281 C563R probably benign Het
Sntg1 A C 1: 8,682,019 V58G possibly damaging Het
Snx11 C T 11: 96,773,159 V36M probably damaging Het
Stk3 C A 15: 34,959,036 S330I probably benign Het
Synpo A G 18: 60,629,559 F92S probably benign Het
Tle1 A G 4: 72,139,687 probably null Het
Tmem117 A G 15: 94,931,803 D173G possibly damaging Het
Tnfrsf19 T C 14: 60,974,698 T168A possibly damaging Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Trim56 G T 5: 137,114,243 Q140K probably damaging Het
Ttn C T 2: 76,732,574 V28679M probably damaging Het
Ubxn8 G A 8: 33,623,203 R208C probably damaging Het
Vmn2r72 G T 7: 85,738,274 S694* probably null Het
Wdr38 T A 2: 39,000,264 W137R probably damaging Het
Zdhhc6 G T 19: 55,304,500 N271K probably damaging Het
Zfyve9 A G 4: 108,718,547 S446P possibly damaging Het
Zmynd8 T C 2: 165,807,572 Q867R possibly damaging Het
Zswim3 T C 2: 164,820,482 I294T probably benign Het
Other mutations in Tmprss5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Tmprss5 APN 9 49109457 makesense probably null
IGL02705:Tmprss5 APN 9 49107147 missense probably benign 0.19
IGL03072:Tmprss5 APN 9 49109018 missense possibly damaging 0.68
IGL03107:Tmprss5 APN 9 49113228 missense possibly damaging 0.78
PIT4366001:Tmprss5 UTSW 9 49112217 missense probably benign 0.24
R0207:Tmprss5 UTSW 9 49113160 missense possibly damaging 0.88
R0477:Tmprss5 UTSW 9 49115165 missense possibly damaging 0.94
R1542:Tmprss5 UTSW 9 49109134 missense possibly damaging 0.81
R1819:Tmprss5 UTSW 9 49107164 missense probably benign 0.09
R2395:Tmprss5 UTSW 9 49115135 nonsense probably null
R4600:Tmprss5 UTSW 9 49113248 missense possibly damaging 0.67
R4967:Tmprss5 UTSW 9 49115517 missense probably damaging 0.98
R5819:Tmprss5 UTSW 9 49114479 splice site probably null
R7876:Tmprss5 UTSW 9 49109091 missense probably benign 0.10
R7959:Tmprss5 UTSW 9 49109091 missense probably benign 0.10
Z1177:Tmprss5 UTSW 9 49115155 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTGGTACATTGTTCAACCTC -3'
(R):5'- CTCCATAGGAATACCCAGGCAG -3'

Sequencing Primer
(F):5'- AACCTCTTTGTCTAGTAAGCTTGG -3'
(R):5'- CAGGGGAATACTCAAGAGTCACC -3'
Posted On2019-06-26