Incidental Mutation 'R7266:Myo1f'
ID564963
Institutional Source Beutler Lab
Gene Symbol Myo1f
Ensembl Gene ENSMUSG00000024300
Gene Namemyosin IF
SynonymsC330006B10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R7266 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33555719-33607764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33601694 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 837 (E837G)
Ref Sequence ENSEMBL: ENSMUSP00000084887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087605] [ENSMUST00000173372]
Predicted Effect probably benign
Transcript: ENSMUST00000087605
AA Change: E837G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084887
Gene: ENSMUSG00000024300
AA Change: E837G

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 717 909 1.7e-51 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 973 987 N/A INTRINSIC
low complexity region 991 1001 N/A INTRINSIC
SH3 1044 1098 2.09e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173372
SMART Domains Protein: ENSMUSP00000134715
Gene: ENSMUSG00000024300

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 716 780 6e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. The protein encoded by this gene is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. There is evidence to suggest that mutations in this gene can result in hearing loss. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T A 8: 24,667,623 I104F probably benign Het
Adgrg7 C T 16: 56,770,311 V166I probably benign Het
Agfg1 G T 1: 82,882,245 V278L probably benign Het
Alpk3 A G 7: 81,092,580 E715G possibly damaging Het
Ap2m1 A G 16: 20,543,345 Y401C probably damaging Het
Arhgef28 C T 13: 97,965,452 S838N probably benign Het
Ash2l A T 8: 25,827,205 Y373* probably null Het
Best2 C T 8: 85,007,764 V442I probably benign Het
Col4a2 T C 8: 11,425,542 probably null Het
Fat2 T A 11: 55,285,030 D1619V probably damaging Het
Fer1l6 A T 15: 58,627,597 N1272I probably benign Het
Gcc1 T A 6: 28,417,996 *779C probably null Het
Gm12216 G A 11: 53,859,251 probably benign Het
Gm17657 C A 17: 29,519,373 V140L probably benign Het
Gm7102 A G 19: 61,175,535 V154A possibly damaging Het
Grm2 C T 9: 106,647,171 V311I Het
Immt T A 6: 71,874,705 D683E probably benign Het
Itga8 T G 2: 12,232,901 D336A probably damaging Het
Jhy T C 9: 40,961,157 T19A probably benign Het
Kcnq2 T C 2: 181,135,092 M1V probably null Het
Kctd17 A T 15: 78,433,014 I117F probably damaging Het
Lrp6 T C 6: 134,507,401 T420A probably damaging Het
Manba T C 3: 135,517,912 S187P probably damaging Het
Mef2b A T 8: 70,164,288 D13V probably damaging Het
Mical2 T C 7: 112,303,756 F145L probably damaging Het
Mphosph8 T A 14: 56,685,040 D551E possibly damaging Het
Myo10 C G 15: 25,782,981 R1170G probably damaging Het
Myo16 A C 8: 10,272,687 Q39P unknown Het
Nell2 T A 15: 95,435,393 I128F possibly damaging Het
Olfr1357 A G 10: 78,612,614 V9A probably benign Het
Pcdh15 A T 10: 74,379,390 R659* probably null Het
Pcdhga1 A G 18: 37,839,975 Q881R possibly damaging Het
Plekhm2 T G 4: 141,642,459 E75A possibly damaging Het
Prc1 A G 7: 80,307,657 K357E possibly damaging Het
Pxk T A 14: 8,146,220 C377S probably benign Het
Ralgapa2 T C 2: 146,334,568 E1696G probably damaging Het
Rbbp6 T A 7: 123,001,367 S1532R unknown Het
Scn5a G T 9: 119,562,560 A22E probably benign Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Siae T C 9: 37,623,013 V115A probably damaging Het
Slc16a6 A G 11: 109,453,281 C563R probably benign Het
Sntg1 A C 1: 8,682,019 V58G possibly damaging Het
Snx11 C T 11: 96,773,159 V36M probably damaging Het
Stk3 C A 15: 34,959,036 S330I probably benign Het
Synpo A G 18: 60,629,559 F92S probably benign Het
Tle1 A G 4: 72,139,687 probably null Het
Tmem117 A G 15: 94,931,803 D173G possibly damaging Het
Tmprss5 T C 9: 49,114,541 W338R probably benign Het
Tnfrsf19 T C 14: 60,974,698 T168A possibly damaging Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Trim56 G T 5: 137,114,243 Q140K probably damaging Het
Ttn C T 2: 76,732,574 V28679M probably damaging Het
Ubxn8 G A 8: 33,623,203 R208C probably damaging Het
Vmn2r72 G T 7: 85,738,274 S694* probably null Het
Wdr38 T A 2: 39,000,264 W137R probably damaging Het
Zdhhc6 G T 19: 55,304,500 N271K probably damaging Het
Zfyve9 A G 4: 108,718,547 S446P possibly damaging Het
Zmynd8 T C 2: 165,807,572 Q867R possibly damaging Het
Zswim3 T C 2: 164,820,482 I294T probably benign Het
Other mutations in Myo1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Myo1f APN 17 33581964 missense probably benign 0.01
IGL01019:Myo1f APN 17 33593003 missense possibly damaging 0.93
IGL01524:Myo1f APN 17 33579883 missense probably damaging 1.00
IGL01744:Myo1f APN 17 33583680 splice site probably benign
IGL01951:Myo1f APN 17 33598017 missense possibly damaging 0.64
IGL02132:Myo1f APN 17 33579971 missense probably benign 0.10
IGL02170:Myo1f APN 17 33578272 missense probably benign 0.14
IGL02173:Myo1f APN 17 33607344 missense probably damaging 1.00
IGL02277:Myo1f APN 17 33579861 splice site probably null
IGL02550:Myo1f APN 17 33588142 missense probably damaging 1.00
IGL02550:Myo1f APN 17 33580150 unclassified probably benign
IGL02615:Myo1f APN 17 33604656 missense probably benign
IGL02801:Myo1f APN 17 33578137 missense probably damaging 1.00
IGL02817:Myo1f APN 17 33604558 missense probably benign 0.06
IGL02904:Myo1f APN 17 33585658 nonsense probably null
IGL03056:Myo1f APN 17 33585600 missense probably damaging 1.00
IGL03334:Myo1f APN 17 33598194 missense probably damaging 1.00
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0321:Myo1f UTSW 17 33593012 missense probably benign 0.31
R0375:Myo1f UTSW 17 33601956 missense probably benign 0.27
R0487:Myo1f UTSW 17 33578284 missense probably damaging 1.00
R0925:Myo1f UTSW 17 33578133 missense probably damaging 0.96
R1394:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1395:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1474:Myo1f UTSW 17 33594027 missense possibly damaging 0.77
R1760:Myo1f UTSW 17 33586198 missense probably benign 0.03
R1965:Myo1f UTSW 17 33598172 nonsense probably null
R2409:Myo1f UTSW 17 33576667 missense probably damaging 1.00
R2432:Myo1f UTSW 17 33575849 missense probably damaging 1.00
R4610:Myo1f UTSW 17 33582332 missense probably damaging 1.00
R4785:Myo1f UTSW 17 33598191 missense possibly damaging 0.95
R5239:Myo1f UTSW 17 33601735 missense probably benign 0.00
R5881:Myo1f UTSW 17 33576653 missense probably damaging 1.00
R5881:Myo1f UTSW 17 33580285 missense possibly damaging 0.46
R6160:Myo1f UTSW 17 33604344 missense probably benign
R6210:Myo1f UTSW 17 33601070 missense probably damaging 1.00
R6365:Myo1f UTSW 17 33586116 missense probably benign
R6464:Myo1f UTSW 17 33576647 missense probably damaging 1.00
R6532:Myo1f UTSW 17 33575846 missense probably damaging 1.00
R6678:Myo1f UTSW 17 33575845 missense probably damaging 1.00
R7241:Myo1f UTSW 17 33579928 missense probably damaging 0.99
R7513:Myo1f UTSW 17 33575814 missense probably damaging 1.00
R7606:Myo1f UTSW 17 33576450 missense probably damaging 1.00
R7779:Myo1f UTSW 17 33578273 missense probably benign 0.27
R7853:Myo1f UTSW 17 33576698 missense probably damaging 1.00
R7884:Myo1f UTSW 17 33598296 missense probably damaging 1.00
R7936:Myo1f UTSW 17 33576698 missense probably damaging 1.00
R7967:Myo1f UTSW 17 33598296 missense probably damaging 1.00
X0028:Myo1f UTSW 17 33576438 missense possibly damaging 0.67
X0065:Myo1f UTSW 17 33601983 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGCAACTCAGGTCCTGCC -3'
(R):5'- ACCCGGAACTGTAGTCTAGG -3'

Sequencing Primer
(F):5'- CATGATCTTTGTGTGGAGACAATTTC -3'
(R):5'- CCTGCAGTAGGTAGGGTGTAC -3'
Posted On2019-06-26