Incidental Mutation 'R0583:Cdk6'
ID56499
Institutional Source Beutler Lab
Gene Symbol Cdk6
Ensembl Gene ENSMUSG00000040274
Gene Namecyclin-dependent kinase 6
SynonymsCrk2
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0583 (G1)
Quality Score95
Status Not validated
Chromosome5
Chromosomal Location3341485-3531008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3473183 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 201 (D201G)
Ref Sequence ENSEMBL: ENSMUSP00000126024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042410] [ENSMUST00000165117]
Predicted Effect probably damaging
Transcript: ENSMUST00000042410
AA Change: D201G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037925
Gene: ENSMUSG00000040274
AA Change: D201G

DomainStartEndE-ValueType
S_TKc 13 300 4.26e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165117
AA Change: D201G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126024
Gene: ENSMUSG00000040274
AA Change: D201G

DomainStartEndE-ValueType
S_TKc 13 300 4.26e-100 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199396
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cyclin dependent kinase family of proteins that play important roles in the progression and regulation of the cell cycle. The encoded protein binds to a D-type cyclin to form an active kinase complex to regulate progression through the G1 phase of the cell cycle. Mice lacking the encoded protein exhibit thymic and splenic hypoplasia, and hematopoietic defects such as reduced number of megakaryocytes and erythrocytes. A pseudogene of this gene has been defined on chromosome 4. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display hematopoietic abnormalities affecting spleen and thymus size. Female body weight and fertility are also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Cdk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Cdk6 UTSW 5 3344211 start gained probably benign
R1474:Cdk6 UTSW 5 3473217 missense probably benign 0.23
R1538:Cdk6 UTSW 5 3520675 missense probably benign 0.02
R2104:Cdk6 UTSW 5 3344387 missense probably benign 0.16
R3029:Cdk6 UTSW 5 3390817 critical splice donor site probably null
R4886:Cdk6 UTSW 5 3344444 missense possibly damaging 0.82
R4939:Cdk6 UTSW 5 3344377 missense probably null 0.99
R5421:Cdk6 UTSW 5 3473120 missense probably damaging 1.00
R5583:Cdk6 UTSW 5 3344436 missense probably damaging 1.00
R6247:Cdk6 UTSW 5 3344553 unclassified probably null
R7014:Cdk6 UTSW 5 3473152 missense probably damaging 1.00
R7102:Cdk6 UTSW 5 3520709 missense probably damaging 1.00
R7288:Cdk6 UTSW 5 3429001 missense probably benign
R8204:Cdk6 UTSW 5 3344461 missense probably damaging 1.00
R8225:Cdk6 UTSW 5 3390790 missense probably benign 0.23
Z1176:Cdk6 UTSW 5 3390694 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AATTTCCTGGCCTGTGGAGTCCTG -3'
(R):5'- GGGTCTTCCTTCACTAAAGAGGTGC -3'

Sequencing Primer
(F):5'- CATGTTGTTACCACGAGGTATAG -3'
(R):5'- GCTTCATGTTTACCAGTTAGGACAG -3'
Posted On2013-07-11