Incidental Mutation 'R7267:Ces1b'
ID564999
Institutional Source Beutler Lab
Gene Symbol Ces1b
Ensembl Gene ENSMUSG00000078964
Gene Namecarboxylesterase 1B
SynonymsGm5158
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7267 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location93056728-93080017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93079504 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 36 (K36N)
Ref Sequence ENSEMBL: ENSMUSP00000105210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109582]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109582
AA Change: K36N

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105210
Gene: ENSMUSG00000078964
AA Change: K36N

DomainStartEndE-ValueType
Pfam:COesterase 1 547 7.6e-168 PFAM
Pfam:Abhydrolase_3 136 245 8.5e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,952,470 I37T probably damaging Het
Ackr2 A G 9: 121,908,808 Y83C probably damaging Het
Adam19 C T 11: 46,121,576 Q300* probably null Het
Anxa7 C T 14: 20,469,406 A115T probably benign Het
Atad2b A T 12: 5,027,105 R1109* probably null Het
Batf2 A G 19: 6,171,366 T69A probably benign Het
Best1 A G 19: 9,986,813 C428R probably benign Het
Birc6 A G 17: 74,585,985 T973A probably benign Het
Bmp2k C T 5: 97,068,434 T597I unknown Het
Bmpr1a G A 14: 34,443,879 P57L possibly damaging Het
Camk2d A T 3: 126,797,730 H283L possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ces2a T A 8: 104,739,040 M308K probably benign Het
Ctnnd2 C A 15: 30,683,355 Q501K probably benign Het
Cyb561d1 T C 3: 108,199,313 T197A probably benign Het
Dedd2 C A 7: 25,218,966 A55S probably damaging Het
Dnah2 C T 11: 69,500,817 R684Q probably damaging Het
Elovl3 A G 19: 46,134,540 Y185C probably damaging Het
Fgf3 C T 7: 144,838,832 A42V probably damaging Het
Gabra5 A G 7: 57,490,781 L56P probably damaging Het
Gm19410 T G 8: 35,814,843 V1860G possibly damaging Het
Gm21663 G T 5: 25,938,753 N190K probably damaging Het
Grm3 T A 5: 9,589,581 I155L probably benign Het
Hadha A G 5: 30,122,757 I495T probably damaging Het
Herc4 C T 10: 63,273,586 A200V possibly damaging Het
Itga3 C A 11: 95,076,362 probably benign Het
Krt6a C T 15: 101,693,854 S132N probably benign Het
Lpar1 T C 4: 58,486,857 N138S possibly damaging Het
Lrrc42 T A 4: 107,239,786 T247S probably damaging Het
Man2b1 T A 8: 85,087,175 V256E probably damaging Het
Map3k4 G T 17: 12,271,649 Y298* probably null Het
Mars A G 10: 127,308,586 V195A probably benign Het
Mdm4 A T 1: 132,994,573 V278E probably benign Het
Mdp1 A G 14: 55,660,087 V37A probably damaging Het
Med13 A G 11: 86,308,826 I685T probably benign Het
Mobp A G 9: 120,167,848 N15S probably damaging Het
Nbn T A 4: 15,979,320 M435K probably benign Het
Nfs1 A G 2: 156,123,783 V126A probably benign Het
Npepl1 T A 2: 174,122,116 V480E probably damaging Het
Nr2e3 G A 9: 59,948,689 S155F possibly damaging Het
Olfr1232 A T 2: 89,325,813 Y122* probably null Het
Olfr638 A G 7: 104,003,839 H188R probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Pard3 T C 8: 127,371,575 Y366H probably damaging Het
Pcdhb11 A G 18: 37,421,953 N112S possibly damaging Het
Pde11a A G 2: 76,337,845 S255P probably damaging Het
Piezo1 T C 8: 122,497,529 H745R Het
Pkn2 A T 3: 142,812,015 S441T possibly damaging Het
Pld1 A C 3: 28,076,401 H450P probably damaging Het
Plekhs1 T A 19: 56,470,777 H22Q probably damaging Het
Prss44 A C 9: 110,816,543 Y285S probably damaging Het
Qpctl T C 7: 19,144,927 E249G probably benign Het
Rcsd1 A T 1: 165,663,616 S50T probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scube1 T A 15: 83,621,065 N496Y probably damaging Het
Slc16a8 AGGCC A 15: 79,251,925 probably null Het
Slc38a4 T A 15: 97,005,900 T407S probably benign Het
Slc51a T G 16: 32,479,772 I56L probably benign Het
Slc6a18 T G 13: 73,671,636 I272L probably damaging Het
Sorl1 A G 9: 42,124,079 L12P possibly damaging Het
Svs1 AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC AGGCCCAGCC 6: 48,988,018 probably benign Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Syne1 C T 10: 5,228,218 R4752Q probably damaging Het
Tbc1d9 C A 8: 83,271,328 H1171Q probably damaging Het
Thsd1 G A 8: 22,243,581 V215I probably benign Het
Tmem143 T A 7: 45,908,174 M208K probably benign Het
Tmem63b C T 17: 45,666,122 V440I probably benign Het
Tnik A T 3: 28,646,627 S918C probably damaging Het
Ttc37 A G 13: 76,180,077 M1415V probably benign Het
Ttn A G 2: 76,903,407 I4508T unknown Het
Vav2 A G 2: 27,283,322 F497L probably damaging Het
Zc3h14 G A 12: 98,785,729 R730Q probably damaging Het
Zfp560 G A 9: 20,348,088 H493Y probably damaging Het
Other mutations in Ces1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ces1b APN 8 93071994 missense probably damaging 0.98
IGL01939:Ces1b APN 8 93079431 missense probably damaging 1.00
IGL02314:Ces1b APN 8 93064896 missense possibly damaging 0.95
IGL02338:Ces1b APN 8 93057047 missense possibly damaging 0.77
IGL02647:Ces1b APN 8 93057044 missense probably benign 0.00
IGL02833:Ces1b APN 8 93079410 missense probably damaging 1.00
IGL03038:Ces1b APN 8 93067052 missense probably benign
IGL03149:Ces1b APN 8 93064874 splice site probably benign
FR4548:Ces1b UTSW 8 93068092 missense probably null
IGL02802:Ces1b UTSW 8 93056966 missense possibly damaging 0.64
R0382:Ces1b UTSW 8 93076052 splice site probably benign
R0893:Ces1b UTSW 8 93079428 missense probably benign 0.11
R0959:Ces1b UTSW 8 93068147 missense probably damaging 1.00
R1386:Ces1b UTSW 8 93068077 missense probably benign 0.02
R1440:Ces1b UTSW 8 93068108 missense probably damaging 0.97
R1667:Ces1b UTSW 8 93056904 missense possibly damaging 0.75
R2113:Ces1b UTSW 8 93068155 missense probably benign
R2193:Ces1b UTSW 8 93079877 missense probably benign 0.00
R2508:Ces1b UTSW 8 93073341 missense possibly damaging 0.75
R4656:Ces1b UTSW 8 93057414 missense probably damaging 0.96
R4776:Ces1b UTSW 8 93063030 missense possibly damaging 0.92
R5108:Ces1b UTSW 8 93071913 missense probably damaging 1.00
R5117:Ces1b UTSW 8 93073209 critical splice donor site probably null
R5308:Ces1b UTSW 8 93067017 missense probably benign 0.00
R5381:Ces1b UTSW 8 93065019 missense probably benign 0.02
R5392:Ces1b UTSW 8 93071962 missense probably damaging 0.98
R5614:Ces1b UTSW 8 93068208 missense probably benign 0.00
R5816:Ces1b UTSW 8 93073262 missense probably benign 0.05
R6554:Ces1b UTSW 8 93064991 missense probably benign 0.03
R6576:Ces1b UTSW 8 93056919 missense probably benign 0.06
R6601:Ces1b UTSW 8 93079481 missense probably benign
R6662:Ces1b UTSW 8 93064069 missense probably benign 0.33
R6753:Ces1b UTSW 8 93067020 nonsense probably null
R6904:Ces1b UTSW 8 93060410 missense probably damaging 0.96
R7371:Ces1b UTSW 8 93057354 critical splice donor site probably null
R7396:Ces1b UTSW 8 93063129 missense probably benign 0.00
X0024:Ces1b UTSW 8 93063017 missense probably benign
Z1088:Ces1b UTSW 8 93064966 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAATCCCCACCCTTGTAACT -3'
(R):5'- ATGGGCGACATTTATACCTCC -3'

Sequencing Primer
(F):5'- CACCCTTGTAACTTACATAGGAGG -3'
(R):5'- CCTCTCTTTAATGTTGGGAGGAAAAG -3'
Posted On2019-06-26