Incidental Mutation 'R7267:Sorl1'
ID565004
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R7267 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42124079 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 12 (L12P)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060989
AA Change: L12P

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: L12P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,952,470 I37T probably damaging Het
Ackr2 A G 9: 121,908,808 Y83C probably damaging Het
Adam19 C T 11: 46,121,576 Q300* probably null Het
Anxa7 C T 14: 20,469,406 A115T probably benign Het
Atad2b A T 12: 5,027,105 R1109* probably null Het
Batf2 A G 19: 6,171,366 T69A probably benign Het
Best1 A G 19: 9,986,813 C428R probably benign Het
Birc6 A G 17: 74,585,985 T973A probably benign Het
Bmp2k C T 5: 97,068,434 T597I unknown Het
Bmpr1a G A 14: 34,443,879 P57L possibly damaging Het
Camk2d A T 3: 126,797,730 H283L possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ces1b C A 8: 93,079,504 K36N possibly damaging Het
Ces2a T A 8: 104,739,040 M308K probably benign Het
Ctnnd2 C A 15: 30,683,355 Q501K probably benign Het
Cyb561d1 T C 3: 108,199,313 T197A probably benign Het
Dedd2 C A 7: 25,218,966 A55S probably damaging Het
Dnah2 C T 11: 69,500,817 R684Q probably damaging Het
Elovl3 A G 19: 46,134,540 Y185C probably damaging Het
Fgf3 C T 7: 144,838,832 A42V probably damaging Het
Gabra5 A G 7: 57,490,781 L56P probably damaging Het
Gm19410 T G 8: 35,814,843 V1860G possibly damaging Het
Gm21663 G T 5: 25,938,753 N190K probably damaging Het
Grm3 T A 5: 9,589,581 I155L probably benign Het
Hadha A G 5: 30,122,757 I495T probably damaging Het
Herc4 C T 10: 63,273,586 A200V possibly damaging Het
Itga3 C A 11: 95,076,362 probably benign Het
Krt6a C T 15: 101,693,854 S132N probably benign Het
Lpar1 T C 4: 58,486,857 N138S possibly damaging Het
Lrrc42 T A 4: 107,239,786 T247S probably damaging Het
Man2b1 T A 8: 85,087,175 V256E probably damaging Het
Map3k4 G T 17: 12,271,649 Y298* probably null Het
Mars A G 10: 127,308,586 V195A probably benign Het
Mdm4 A T 1: 132,994,573 V278E probably benign Het
Mdp1 A G 14: 55,660,087 V37A probably damaging Het
Med13 A G 11: 86,308,826 I685T probably benign Het
Mobp A G 9: 120,167,848 N15S probably damaging Het
Nbn T A 4: 15,979,320 M435K probably benign Het
Nfs1 A G 2: 156,123,783 V126A probably benign Het
Npepl1 T A 2: 174,122,116 V480E probably damaging Het
Nr2e3 G A 9: 59,948,689 S155F possibly damaging Het
Olfr1232 A T 2: 89,325,813 Y122* probably null Het
Olfr638 A G 7: 104,003,839 H188R probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Pard3 T C 8: 127,371,575 Y366H probably damaging Het
Pcdhb11 A G 18: 37,421,953 N112S possibly damaging Het
Pde11a A G 2: 76,337,845 S255P probably damaging Het
Piezo1 T C 8: 122,497,529 H745R Het
Pkn2 A T 3: 142,812,015 S441T possibly damaging Het
Pld1 A C 3: 28,076,401 H450P probably damaging Het
Plekhs1 T A 19: 56,470,777 H22Q probably damaging Het
Prss44 A C 9: 110,816,543 Y285S probably damaging Het
Qpctl T C 7: 19,144,927 E249G probably benign Het
Rcsd1 A T 1: 165,663,616 S50T probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scube1 T A 15: 83,621,065 N496Y probably damaging Het
Slc16a8 AGGCC A 15: 79,251,925 probably null Het
Slc38a4 T A 15: 97,005,900 T407S probably benign Het
Slc51a T G 16: 32,479,772 I56L probably benign Het
Slc6a18 T G 13: 73,671,636 I272L probably damaging Het
Svs1 AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC AGGCCCAGCC 6: 48,988,018 probably benign Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Syne1 C T 10: 5,228,218 R4752Q probably damaging Het
Tbc1d9 C A 8: 83,271,328 H1171Q probably damaging Het
Thsd1 G A 8: 22,243,581 V215I probably benign Het
Tmem143 T A 7: 45,908,174 M208K probably benign Het
Tmem63b C T 17: 45,666,122 V440I probably benign Het
Tnik A T 3: 28,646,627 S918C probably damaging Het
Ttc37 A G 13: 76,180,077 M1415V probably benign Het
Ttn A G 2: 76,903,407 I4508T unknown Het
Vav2 A G 2: 27,283,322 F497L probably damaging Het
Zc3h14 G A 12: 98,785,729 R730Q probably damaging Het
Zfp560 G A 9: 20,348,088 H493Y probably damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
R7272:Sorl1 UTSW 9 42063710 splice site probably null
R7537:Sorl1 UTSW 9 41980688 missense probably benign 0.01
R7615:Sorl1 UTSW 9 41977582 missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42092334 missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41984526 missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAGTGCTCACCTGTCCATACAC -3'
(R):5'- GCAACTCTTCACTGCGGTAG -3'

Sequencing Primer
(F):5'- TCCTGAGTGGCTTCCTGGC -3'
(R):5'- TGCGAGCTCACACGTGAC -3'
Posted On2019-06-26