Incidental Mutation 'R7267:Itga3'
ID565015
Institutional Source Beutler Lab
Gene Symbol Itga3
Ensembl Gene ENSMUSG00000001507
Gene Nameintegrin alpha 3
SynonymsVLA-3 alpha 3, alpha3-integrin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7267 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location95044474-95076801 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 95076362 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000001548] [ENSMUST00000120375]
Predicted Effect probably benign
Transcript: ENSMUST00000001548
SMART Domains Protein: ENSMUSP00000001548
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 7e-54 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120375
SMART Domains Protein: ENSMUSP00000113556
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 2e-53 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145671
SMART Domains Protein: ENSMUSP00000115970
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
Blast:Int_alpha 6 52 3e-22 BLAST
SCOP:d1m1xa4 8 182 3e-24 SMART
PDB:4IRZ|A 12 168 2e-8 PDB
Blast:Int_alpha 55 88 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of integrin family of cell surface proteins. The encoded protein undergoes post-translational processing to form a disulfide bond-linked dimer comprised of heavy and light chains. At the cell surface, the encoded protein non-covalently associates with the integrin beta-1 subunit to form a heterodimer that interacts with many extracellular matrix proteins including fibronectin and laminin. Mice lacking the encoded protein die during the first day after birth due to severe abnormalities in kidneys. Mice lacking the encoded protein specifically in the basal layer of epidermis display several skin defects and accelerated wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the kidney and submandibular gland, decreased bronchial branching of the lungs, skin blisters at the dermal-epidermal junction, abnormal layering of the cerebral cortex and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,952,470 I37T probably damaging Het
Ackr2 A G 9: 121,908,808 Y83C probably damaging Het
Adam19 C T 11: 46,121,576 Q300* probably null Het
Anxa7 C T 14: 20,469,406 A115T probably benign Het
Atad2b A T 12: 5,027,105 R1109* probably null Het
Batf2 A G 19: 6,171,366 T69A probably benign Het
Best1 A G 19: 9,986,813 C428R probably benign Het
Birc6 A G 17: 74,585,985 T973A probably benign Het
Bmp2k C T 5: 97,068,434 T597I unknown Het
Bmpr1a G A 14: 34,443,879 P57L possibly damaging Het
Camk2d A T 3: 126,797,730 H283L possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ces1b C A 8: 93,079,504 K36N possibly damaging Het
Ces2a T A 8: 104,739,040 M308K probably benign Het
Ctnnd2 C A 15: 30,683,355 Q501K probably benign Het
Cyb561d1 T C 3: 108,199,313 T197A probably benign Het
Dedd2 C A 7: 25,218,966 A55S probably damaging Het
Dnah2 C T 11: 69,500,817 R684Q probably damaging Het
Elovl3 A G 19: 46,134,540 Y185C probably damaging Het
Fgf3 C T 7: 144,838,832 A42V probably damaging Het
Gabra5 A G 7: 57,490,781 L56P probably damaging Het
Gm19410 T G 8: 35,814,843 V1860G possibly damaging Het
Gm21663 G T 5: 25,938,753 N190K probably damaging Het
Grm3 T A 5: 9,589,581 I155L probably benign Het
Hadha A G 5: 30,122,757 I495T probably damaging Het
Herc4 C T 10: 63,273,586 A200V possibly damaging Het
Krt6a C T 15: 101,693,854 S132N probably benign Het
Lpar1 T C 4: 58,486,857 N138S possibly damaging Het
Lrrc42 T A 4: 107,239,786 T247S probably damaging Het
Man2b1 T A 8: 85,087,175 V256E probably damaging Het
Map3k4 G T 17: 12,271,649 Y298* probably null Het
Mars A G 10: 127,308,586 V195A probably benign Het
Mdm4 A T 1: 132,994,573 V278E probably benign Het
Mdp1 A G 14: 55,660,087 V37A probably damaging Het
Med13 A G 11: 86,308,826 I685T probably benign Het
Mobp A G 9: 120,167,848 N15S probably damaging Het
Nbn T A 4: 15,979,320 M435K probably benign Het
Nfs1 A G 2: 156,123,783 V126A probably benign Het
Npepl1 T A 2: 174,122,116 V480E probably damaging Het
Nr2e3 G A 9: 59,948,689 S155F possibly damaging Het
Olfr1232 A T 2: 89,325,813 Y122* probably null Het
Olfr638 A G 7: 104,003,839 H188R probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Pard3 T C 8: 127,371,575 Y366H probably damaging Het
Pcdhb11 A G 18: 37,421,953 N112S possibly damaging Het
Pde11a A G 2: 76,337,845 S255P probably damaging Het
Piezo1 T C 8: 122,497,529 H745R Het
Pkn2 A T 3: 142,812,015 S441T possibly damaging Het
Pld1 A C 3: 28,076,401 H450P probably damaging Het
Plekhs1 T A 19: 56,470,777 H22Q probably damaging Het
Prss44 A C 9: 110,816,543 Y285S probably damaging Het
Qpctl T C 7: 19,144,927 E249G probably benign Het
Rcsd1 A T 1: 165,663,616 S50T probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scube1 T A 15: 83,621,065 N496Y probably damaging Het
Slc16a8 AGGCC A 15: 79,251,925 probably null Het
Slc38a4 T A 15: 97,005,900 T407S probably benign Het
Slc51a T G 16: 32,479,772 I56L probably benign Het
Slc6a18 T G 13: 73,671,636 I272L probably damaging Het
Sorl1 A G 9: 42,124,079 L12P possibly damaging Het
Svs1 AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC AGGCCCAGCC 6: 48,988,018 probably benign Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Syne1 C T 10: 5,228,218 R4752Q probably damaging Het
Tbc1d9 C A 8: 83,271,328 H1171Q probably damaging Het
Thsd1 G A 8: 22,243,581 V215I probably benign Het
Tmem143 T A 7: 45,908,174 M208K probably benign Het
Tmem63b C T 17: 45,666,122 V440I probably benign Het
Tnik A T 3: 28,646,627 S918C probably damaging Het
Ttc37 A G 13: 76,180,077 M1415V probably benign Het
Ttn A G 2: 76,903,407 I4508T unknown Het
Vav2 A G 2: 27,283,322 F497L probably damaging Het
Zc3h14 G A 12: 98,785,729 R730Q probably damaging Het
Zfp560 G A 9: 20,348,088 H493Y probably damaging Het
Other mutations in Itga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Itga3 APN 11 95065886 missense probably damaging 1.00
IGL02020:Itga3 APN 11 95057390 missense probably benign 0.02
IGL02413:Itga3 APN 11 95068771 missense probably damaging 1.00
IGL02562:Itga3 APN 11 95068793 missense probably benign 0.02
PIT4508001:Itga3 UTSW 11 95055893 missense probably benign 0.20
R0485:Itga3 UTSW 11 95061970 missense probably benign 0.05
R1548:Itga3 UTSW 11 95046919 critical splice donor site probably null
R1677:Itga3 UTSW 11 95055759 missense probably damaging 0.96
R2062:Itga3 UTSW 11 95054076 missense possibly damaging 0.92
R2088:Itga3 UTSW 11 95052494 missense probably benign 0.10
R2679:Itga3 UTSW 11 95068310 splice site probably benign
R3697:Itga3 UTSW 11 95062725 missense probably benign 0.00
R3839:Itga3 UTSW 11 95057269 critical splice donor site probably null
R4210:Itga3 UTSW 11 95062623 missense probably benign 0.00
R4533:Itga3 UTSW 11 95057293 missense probably benign 0.15
R4849:Itga3 UTSW 11 95076271 missense probably benign
R4863:Itga3 UTSW 11 95061967 missense probably damaging 1.00
R4889:Itga3 UTSW 11 95068301 missense probably benign 0.13
R5218:Itga3 UTSW 11 95062748 missense probably benign 0.01
R6046:Itga3 UTSW 11 95062715 missense probably benign 0.28
R6087:Itga3 UTSW 11 95052443 critical splice donor site probably null
R6210:Itga3 UTSW 11 95068891 intron probably benign
R6341:Itga3 UTSW 11 95055851 splice site probably null
R6666:Itga3 UTSW 11 95065826 missense probably benign 0.00
R6998:Itga3 UTSW 11 95051462 missense probably benign 0.00
R7106:Itga3 UTSW 11 95055873 missense probably benign 0.00
R7164:Itga3 UTSW 11 95052479 missense possibly damaging 0.85
R7421:Itga3 UTSW 11 95068855 missense probably benign 0.20
R7514:Itga3 UTSW 11 95065896 nonsense probably null
R7533:Itga3 UTSW 11 95046518 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CTTACAGGTAGCGCTGTTGTC -3'
(R):5'- ACGGATTGGAAAAGCACCCG -3'

Sequencing Primer
(F):5'- TGTCGCTCAGTCTGCCGATG -3'
(R):5'- AAGCACCCGGAGCAGACG -3'
Posted On2019-06-26