Incidental Mutation 'R7267:Atad2b'
ID565016
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene NameATPase family, AAA domain containing 2B
SynonymsD530031C13Rik, 1110014E10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7267 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location4917353-5047394 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 5027105 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1109 (R1109*)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664]
Predicted Effect probably null
Transcript: ENSMUST00000045664
AA Change: R1109*
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: R1109*

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,952,470 I37T probably damaging Het
Ackr2 A G 9: 121,908,808 Y83C probably damaging Het
Adam19 C T 11: 46,121,576 Q300* probably null Het
Anxa7 C T 14: 20,469,406 A115T probably benign Het
Batf2 A G 19: 6,171,366 T69A probably benign Het
Best1 A G 19: 9,986,813 C428R probably benign Het
Birc6 A G 17: 74,585,985 T973A probably benign Het
Bmp2k C T 5: 97,068,434 T597I unknown Het
Bmpr1a G A 14: 34,443,879 P57L possibly damaging Het
Camk2d A T 3: 126,797,730 H283L possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ces1b C A 8: 93,079,504 K36N possibly damaging Het
Ces2a T A 8: 104,739,040 M308K probably benign Het
Ctnnd2 C A 15: 30,683,355 Q501K probably benign Het
Cyb561d1 T C 3: 108,199,313 T197A probably benign Het
Dedd2 C A 7: 25,218,966 A55S probably damaging Het
Dnah2 C T 11: 69,500,817 R684Q probably damaging Het
Elovl3 A G 19: 46,134,540 Y185C probably damaging Het
Fgf3 C T 7: 144,838,832 A42V probably damaging Het
Gabra5 A G 7: 57,490,781 L56P probably damaging Het
Gm19410 T G 8: 35,814,843 V1860G possibly damaging Het
Gm21663 G T 5: 25,938,753 N190K probably damaging Het
Grm3 T A 5: 9,589,581 I155L probably benign Het
Hadha A G 5: 30,122,757 I495T probably damaging Het
Herc4 C T 10: 63,273,586 A200V possibly damaging Het
Itga3 C A 11: 95,076,362 probably benign Het
Krt6a C T 15: 101,693,854 S132N probably benign Het
Lpar1 T C 4: 58,486,857 N138S possibly damaging Het
Lrrc42 T A 4: 107,239,786 T247S probably damaging Het
Man2b1 T A 8: 85,087,175 V256E probably damaging Het
Map3k4 G T 17: 12,271,649 Y298* probably null Het
Mars A G 10: 127,308,586 V195A probably benign Het
Mdm4 A T 1: 132,994,573 V278E probably benign Het
Mdp1 A G 14: 55,660,087 V37A probably damaging Het
Med13 A G 11: 86,308,826 I685T probably benign Het
Mobp A G 9: 120,167,848 N15S probably damaging Het
Nbn T A 4: 15,979,320 M435K probably benign Het
Nfs1 A G 2: 156,123,783 V126A probably benign Het
Npepl1 T A 2: 174,122,116 V480E probably damaging Het
Nr2e3 G A 9: 59,948,689 S155F possibly damaging Het
Olfr1232 A T 2: 89,325,813 Y122* probably null Het
Olfr638 A G 7: 104,003,839 H188R probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Pard3 T C 8: 127,371,575 Y366H probably damaging Het
Pcdhb11 A G 18: 37,421,953 N112S possibly damaging Het
Pde11a A G 2: 76,337,845 S255P probably damaging Het
Piezo1 T C 8: 122,497,529 H745R Het
Pkn2 A T 3: 142,812,015 S441T possibly damaging Het
Pld1 A C 3: 28,076,401 H450P probably damaging Het
Plekhs1 T A 19: 56,470,777 H22Q probably damaging Het
Prss44 A C 9: 110,816,543 Y285S probably damaging Het
Qpctl T C 7: 19,144,927 E249G probably benign Het
Rcsd1 A T 1: 165,663,616 S50T probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scube1 T A 15: 83,621,065 N496Y probably damaging Het
Slc16a8 AGGCC A 15: 79,251,925 probably null Het
Slc38a4 T A 15: 97,005,900 T407S probably benign Het
Slc51a T G 16: 32,479,772 I56L probably benign Het
Slc6a18 T G 13: 73,671,636 I272L probably damaging Het
Sorl1 A G 9: 42,124,079 L12P possibly damaging Het
Svs1 AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC AGGCCCAGCC 6: 48,988,018 probably benign Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Syne1 C T 10: 5,228,218 R4752Q probably damaging Het
Tbc1d9 C A 8: 83,271,328 H1171Q probably damaging Het
Thsd1 G A 8: 22,243,581 V215I probably benign Het
Tmem143 T A 7: 45,908,174 M208K probably benign Het
Tmem63b C T 17: 45,666,122 V440I probably benign Het
Tnik A T 3: 28,646,627 S918C probably damaging Het
Ttc37 A G 13: 76,180,077 M1415V probably benign Het
Ttn A G 2: 76,903,407 I4508T unknown Het
Vav2 A G 2: 27,283,322 F497L probably damaging Het
Zc3h14 G A 12: 98,785,729 R730Q probably damaging Het
Zfp560 G A 9: 20,348,088 H493Y probably damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTGAAGGATAAGCATGGCCTG -3'
(R):5'- TCTGGAAAGGTGACCAAGAC -3'

Sequencing Primer
(F):5'- TTTCACCAGAATTACAAACTGTCCAG -3'
(R):5'- TGACCAAGACTAAAGAGCTATAGAC -3'
Posted On2019-06-26