Incidental Mutation 'R0583:Cntn6'
ID56503
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Namecontactin 6
SynonymsNB-3
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0583 (G1)
Quality Score120
Status Not validated
Chromosome6
Chromosomal Location104492790-104863406 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104776314 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 337 (D337G)
Ref Sequence ENSEMBL: ENSMUSP00000124714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089215
AA Change: D409G

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: D409G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161070
AA Change: D337G

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: D337G

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162872
AA Change: D409G

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: D409G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104650400 missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104774523 missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104728374 splice site probably benign
IGL02028:Cntn6 APN 6 104859426 missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104846142 critical splice donor site probably null
IGL02557:Cntn6 APN 6 104774535 missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104804386 missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104804338 missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104776457 splice site probably benign
PIT4366001:Cntn6 UTSW 6 104832537 missense probably benign 0.05
R0490:Cntn6 UTSW 6 104833918 missense possibly damaging 0.91
R0636:Cntn6 UTSW 6 104863148 missense probably benign 0.00
R0654:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R0960:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R1241:Cntn6 UTSW 6 104832509 missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104861900 missense probably benign 0.07
R1401:Cntn6 UTSW 6 104804398 missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R1542:Cntn6 UTSW 6 104848100 missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104832580 missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104774480 missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104861822 nonsense probably null
R2097:Cntn6 UTSW 6 104861949 missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104569028 start gained probably benign
R2429:Cntn6 UTSW 6 104650565 missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104726237 missense probably benign 0.04
R4009:Cntn6 UTSW 6 104833822 missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104772561 missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4666:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4701:Cntn6 UTSW 6 104804360 missense probably benign 0.01
R4780:Cntn6 UTSW 6 104845784 missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104859475 missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104774474 missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104772597 missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104833030 missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104569113 intron probably benign
R5291:Cntn6 UTSW 6 104726135 missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104832562 missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104835745 missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104833103 missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104848132 missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104767890 missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104726139 missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104650500 missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104859448 missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104861946 missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104845758 frame shift probably null
R7012:Cntn6 UTSW 6 104726262 missense probably damaging 0.98
R7012:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R7337:Cntn6 UTSW 6 104650530 missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104650483 missense probably benign 0.29
R8133:Cntn6 UTSW 6 104728337 missense probably benign 0.19
X0020:Cntn6 UTSW 6 104767884 missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104832584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAACATAACCACGTCTGACAAATGG -3'
(R):5'- AAGTTTTGGCACCTTGGGAGTACC -3'

Sequencing Primer
(F):5'- CTGTAGACGACACATATCATTTCC -3'
(R):5'- GGAGTACCCCACAGGAAGTTTATTAC -3'
Posted On2013-07-11