Incidental Mutation 'R0583:Clec4e'
ID56505
Institutional Source Beutler Lab
Gene Symbol Clec4e
Ensembl Gene ENSMUSG00000030142
Gene NameC-type lectin domain family 4, member e
SynonymsClecsf9, Mincle
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0583 (G1)
Quality Score150
Status Not validated
Chromosome6
Chromosomal Location123281789-123289870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123283694 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 135 (F135S)
Ref Sequence ENSEMBL: ENSMUSP00000135081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032239] [ENSMUST00000176096] [ENSMUST00000177367]
Predicted Effect probably damaging
Transcript: ENSMUST00000032239
AA Change: F164S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032239
Gene: ENSMUSG00000030142
AA Change: F164S

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
CLECT 80 206 4.82e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175995
Predicted Effect probably benign
Transcript: ENSMUST00000176096
SMART Domains Protein: ENSMUSP00000135682
Gene: ENSMUSG00000030142

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176831
Predicted Effect probably damaging
Transcript: ENSMUST00000177367
AA Change: F135S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135081
Gene: ENSMUSG00000030142
AA Change: F135S

DomainStartEndE-ValueType
CLECT 51 177 4.82e-36 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type II transmembrane protein is a downstream target of CCAAT/enhancer binding protein (C/EBP), beta (CEBPB) and may play a role in inflammation. Alternative splice variants have been described but their full-length sequence has not been determined. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation exhibit reduced cytokine (TNF) production after challenge with C. albicans and are more susceptible to systemic candidiasis. The majority of homozygotes also display histological evidence of abnormal heart valves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Clec4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02713:Clec4e APN 6 123286304 nonsense probably null
IGL03051:Clec4e APN 6 123289733 missense probably benign 0.02
IGL03201:Clec4e APN 6 123283640 missense probably benign 0.03
R1467:Clec4e UTSW 6 123285461 splice site probably benign
R1818:Clec4e UTSW 6 123285493 missense possibly damaging 0.87
R1826:Clec4e UTSW 6 123283632 missense probably damaging 1.00
R1968:Clec4e UTSW 6 123283574 missense probably damaging 1.00
R2435:Clec4e UTSW 6 123288896 missense probably damaging 0.99
R4530:Clec4e UTSW 6 123289774 utr 5 prime probably benign
R6891:Clec4e UTSW 6 123283606 missense probably damaging 1.00
R7531:Clec4e UTSW 6 123285574 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GTGCAGTCCTTCTGATGCCTGATAG -3'
(R):5'- ACATATGCCAGGCCAGCAGTACTC -3'

Sequencing Primer
(F):5'- GCATGTAAGCCATGTCCCTTG -3'
(R):5'- GCAGTACTCACCATGATGCC -3'
Posted On2013-07-11