Incidental Mutation 'R7268:Babam2'
ID565063
Institutional Source Beutler Lab
Gene Symbol Babam2
Ensembl Gene ENSMUSG00000052139
Gene NameBRISC and BRCA1 A complex member 2
SynonymsBre, 6030405P19Rik, B830038C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31697684-32084962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31701853 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000069133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031018] [ENSMUST00000063813] [ENSMUST00000071531] [ENSMUST00000114507] [ENSMUST00000114515] [ENSMUST00000131995] [ENSMUST00000200705] [ENSMUST00000201352] [ENSMUST00000202293] [ENSMUST00000202815]
Predicted Effect probably benign
Transcript: ENSMUST00000031018
SMART Domains Protein: ENSMUSP00000031018
Gene: ENSMUSG00000029136

DomainStartEndE-ValueType
Pfam:PfkB 16 315 2.1e-66 PFAM
Pfam:Phos_pyr_kin 166 306 9.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063813
AA Change: S2P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069133
Gene: ENSMUSG00000052139
AA Change: S2P

DomainStartEndE-ValueType
Pfam:BRE 70 370 3.4e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071531
SMART Domains Protein: ENSMUSP00000071462
Gene: ENSMUSG00000052139

DomainStartEndE-ValueType
Pfam:BRE 28 324 2.2e-204 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114507
SMART Domains Protein: ENSMUSP00000110152
Gene: ENSMUSG00000052139

DomainStartEndE-ValueType
Pfam:BRE 3 269 9.5e-182 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114515
AA Change: S2P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110160
Gene: ENSMUSG00000052139
AA Change: S2P

DomainStartEndE-ValueType
Pfam:BRE 1 333 4.9e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131995
SMART Domains Protein: ENSMUSP00000128351
Gene: ENSMUSG00000052139

DomainStartEndE-ValueType
Pfam:BRE 1 195 4.3e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200705
AA Change: S2P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143964
Gene: ENSMUSG00000052139
AA Change: S2P

DomainStartEndE-ValueType
Pfam:BRE 8 204 1.6e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201352
AA Change: S2P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144205
Gene: ENSMUSG00000052139
AA Change: S2P

DomainStartEndE-ValueType
Pfam:BRE 8 333 8.1e-146 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202293
AA Change: S2P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000202815
AA Change: S2P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144497
Gene: ENSMUSG00000052139
AA Change: S2P

DomainStartEndE-ValueType
Pfam:BRE 8 63 1.2e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an anti-apoptotic, death receptor-associated protein that interacts with tumor necrosis factor-receptor-1. The encoded protein acts as an adapter in several protein complexes, including the BRCA1-A complex and the BRISC complex. The BRCA1-A complex possesses ubiquitinase activity and targets sites of double strand DNA breaks, while the BRISC complex exhibits deubiquitinase activity and is involved in mitotic spindle assembly. This gene is upregulated in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. However, fibroblasts exhibit decreased proliferation and increased cellular replicative senescence in response to irradiation and hydrogen peroxide with impaired DNA damage repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Babam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Babam2 APN 5 32007307 missense probably damaging 1.00
IGL01815:Babam2 APN 5 31702098 missense possibly damaging 0.90
IGL02869:Babam2 APN 5 32004772 missense possibly damaging 0.92
IGL03091:Babam2 APN 5 31785678 splice site probably null
IGL03185:Babam2 APN 5 31702032 missense possibly damaging 0.60
R1817:Babam2 UTSW 5 32057546 missense probably damaging 0.99
R4012:Babam2 UTSW 5 32001438 missense probably damaging 1.00
R4257:Babam2 UTSW 5 31702070 missense possibly damaging 0.76
R4522:Babam2 UTSW 5 32007242 missense probably damaging 1.00
R4622:Babam2 UTSW 5 32007312 missense probably damaging 0.99
R4738:Babam2 UTSW 5 31901142 missense probably damaging 0.99
R4752:Babam2 UTSW 5 31702047 intron probably benign
R4927:Babam2 UTSW 5 31702064 missense probably benign 0.00
R4962:Babam2 UTSW 5 31785583 missense possibly damaging 0.75
R5374:Babam2 UTSW 5 32007230 splice site probably benign
R5375:Babam2 UTSW 5 31701863 missense possibly damaging 0.52
R5453:Babam2 UTSW 5 32007246 missense probably damaging 1.00
R5890:Babam2 UTSW 5 32064807 intron probably benign
R5915:Babam2 UTSW 5 31785611 missense probably damaging 1.00
R5982:Babam2 UTSW 5 31820620 missense possibly damaging 0.86
R6271:Babam2 UTSW 5 32001362 missense probably damaging 1.00
R7352:Babam2 UTSW 5 32007250 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGGCTCCTGGAAGACTAAG -3'
(R):5'- TTGAATGAAAGCTTCTGTGACGG -3'

Sequencing Primer
(F):5'- CTCCTGGAAGACTAAGTGGTACTG -3'
(R):5'- GACGGCCCTTTTTCATGGATCTG -3'
Posted On2019-06-26