Incidental Mutation 'R7268:Prr27'
ID565064
Institutional Source Beutler Lab
Gene Symbol Prr27
Ensembl Gene ENSMUSG00000002240
Gene Nameproline rich 27
Synonyms4930432K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location87825686-87846387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87843276 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 249 (L249P)
Ref Sequence ENSEMBL: ENSMUSP00000098617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002310] [ENSMUST00000101056]
Predicted Effect probably damaging
Transcript: ENSMUST00000002310
AA Change: L241P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002310
Gene: ENSMUSG00000002240
AA Change: L241P

DomainStartEndE-ValueType
low complexity region 49 57 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
low complexity region 137 153 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101056
AA Change: L249P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098617
Gene: ENSMUSG00000002240
AA Change: L249P

DomainStartEndE-ValueType
low complexity region 57 65 N/A INTRINSIC
low complexity region 112 138 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Prr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Prr27 APN 5 87843443 missense possibly damaging 0.90
IGL02617:Prr27 APN 5 87842659 missense probably benign 0.00
IGL02995:Prr27 APN 5 87842816 missense probably benign
IGL03270:Prr27 APN 5 87835678 utr 5 prime probably benign
R0531:Prr27 UTSW 5 87842678 missense probably benign 0.02
R0637:Prr27 UTSW 5 87851146 unclassified probably benign
R1498:Prr27 UTSW 5 87850741 unclassified probably benign
R1599:Prr27 UTSW 5 87843225 missense probably benign 0.00
R1744:Prr27 UTSW 5 87843047 missense possibly damaging 0.46
R1980:Prr27 UTSW 5 87843402 missense probably benign 0.03
R4033:Prr27 UTSW 5 87843305 nonsense probably null
R4304:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4306:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4307:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4308:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4347:Prr27 UTSW 5 87842672 missense possibly damaging 0.46
R4675:Prr27 UTSW 5 87843241 missense possibly damaging 0.94
R4826:Prr27 UTSW 5 87850966 unclassified probably benign
R4908:Prr27 UTSW 5 87843029 missense probably benign 0.01
R5361:Prr27 UTSW 5 87843344 missense probably damaging 0.96
R5426:Prr27 UTSW 5 87850885 unclassified probably benign
R7785:Prr27 UTSW 5 87843272 missense probably benign
R8087:Prr27 UTSW 5 87846309 missense probably benign 0.00
R8250:Prr27 UTSW 5 87842697 missense possibly damaging 0.89
R8270:Prr27 UTSW 5 87846312 missense possibly damaging 0.82
R8375:Prr27 UTSW 5 87842851 nonsense probably null
Z1088:Prr27 UTSW 5 87842646 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCAGTCAAACTTGGAACAC -3'
(R):5'- TTTTCCCACAACAGACTGGC -3'

Sequencing Primer
(F):5'- GTCAAACTTGGAACACCCGTG -3'
(R):5'- AGACTGGCTCGCCATAAGTTCAG -3'
Posted On2019-06-26