Incidental Mutation 'R7268:Atp2a2'
ID565068
Institutional Source Beutler Lab
Gene Symbol Atp2a2
Ensembl Gene ENSMUSG00000029467
Gene NameATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Synonyms9530097L16Rik, SERCA2, D5Wsu150e, SERCA2B, sarco/endoplasmic reticulum Ca2+-ATPase 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122453513-122502225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122467729 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 388 (T388A)
Ref Sequence ENSEMBL: ENSMUSP00000031423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031423] [ENSMUST00000177974] [ENSMUST00000179939]
Predicted Effect probably benign
Transcript: ENSMUST00000031423
AA Change: T388A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031423
Gene: ENSMUSG00000029467
AA Change: T388A

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 92 340 2.1e-66 PFAM
Pfam:Hydrolase 345 714 1.2e-18 PFAM
Pfam:HAD 348 711 1e-18 PFAM
Pfam:Cation_ATPase 418 527 2.5e-24 PFAM
Pfam:Hydrolase_3 682 746 1.9e-7 PFAM
Pfam:Cation_ATPase_C 783 986 2.4e-48 PFAM
transmembrane domain 1015 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177974
AA Change: T388A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136104
Gene: ENSMUSG00000029467
AA Change: T388A

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 92 340 5.1e-66 PFAM
Pfam:Hydrolase 345 714 2.7e-18 PFAM
Pfam:HAD 348 711 2.6e-18 PFAM
Pfam:Cation_ATPase 418 527 4.7e-24 PFAM
Pfam:Hydrolase_3 682 746 7.2e-7 PFAM
Pfam:Cation_ATPase_C 783 986 5.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179939
AA Change: T388A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135935
Gene: ENSMUSG00000029467
AA Change: T388A

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 93 341 9e-69 PFAM
Pfam:HAD 348 711 1.2e-16 PFAM
Pfam:Hydrolase_like2 418 527 3.1e-24 PFAM
Pfam:Hydrolase 496 714 8.7e-24 PFAM
Pfam:Hydrolase_3 682 746 3.4e-7 PFAM
Pfam:Cation_ATPase_C 783 986 1.6e-47 PFAM
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the sarcoplasmic reticulum lumen, and is involved in regulation of the contraction/relaxation cycle. Mutations in this gene cause Darier-White disease, also known as keratosis follicularis, an autosomal dominant skin disorder characterized by loss of adhesion between epidermal cells and abnormal keratinization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Targeted homozygous mutants are embryonic lethal while heterozygotes show reduced blood pressure and mildly impaired cardiac contractility and relaxation. Aged heterozygotes for one targeted mutation develop squamous cell tumors of the forestomach, esophagus, oral mucosa, tongue, and skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Atp2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Atp2a2 APN 5 122458083 splice site probably null
IGL01459:Atp2a2 APN 5 122469652 missense probably benign 0.03
IGL01721:Atp2a2 APN 5 122500792 missense possibly damaging 0.89
IGL02614:Atp2a2 APN 5 122489303 missense probably benign 0.00
IGL02616:Atp2a2 APN 5 122461684 missense probably benign 0.07
IGL02826:Atp2a2 APN 5 122489291 missense probably benign 0.03
IGL02876:Atp2a2 APN 5 122466008 missense probably benign 0.18
PIT4458001:Atp2a2 UTSW 5 122457309 nonsense probably null
R0087:Atp2a2 UTSW 5 122460961 missense probably benign 0.02
R0139:Atp2a2 UTSW 5 122491715 missense probably damaging 1.00
R0166:Atp2a2 UTSW 5 122466838 missense possibly damaging 0.69
R0457:Atp2a2 UTSW 5 122469714 missense probably benign
R0658:Atp2a2 UTSW 5 122457633 splice site probably benign
R0815:Atp2a2 UTSW 5 122471236 missense probably benign 0.02
R1282:Atp2a2 UTSW 5 122491754 missense probably benign 0.00
R1538:Atp2a2 UTSW 5 122457377 missense probably damaging 1.00
R1985:Atp2a2 UTSW 5 122466836 missense probably benign 0.03
R2111:Atp2a2 UTSW 5 122459546 missense probably damaging 1.00
R2517:Atp2a2 UTSW 5 122457513 missense probably damaging 0.99
R4225:Atp2a2 UTSW 5 122469726 missense probably benign
R4473:Atp2a2 UTSW 5 122457264 missense probably benign 0.01
R4956:Atp2a2 UTSW 5 122461580 missense probably benign 0.02
R4969:Atp2a2 UTSW 5 122458491 missense possibly damaging 0.95
R5242:Atp2a2 UTSW 5 122461946 missense probably damaging 1.00
R5307:Atp2a2 UTSW 5 122461747 missense probably benign 0.06
R5497:Atp2a2 UTSW 5 122458169 missense probably damaging 1.00
R5536:Atp2a2 UTSW 5 122457182 missense probably benign 0.05
R5629:Atp2a2 UTSW 5 122460096 missense probably damaging 1.00
R5641:Atp2a2 UTSW 5 122457576 missense probably damaging 1.00
R6365:Atp2a2 UTSW 5 122461916 missense probably benign 0.20
R6383:Atp2a2 UTSW 5 122501649 missense probably benign 0.37
R6534:Atp2a2 UTSW 5 122457198 missense possibly damaging 0.73
R7162:Atp2a2 UTSW 5 122489324 missense probably benign 0.00
R7259:Atp2a2 UTSW 5 122466069 missense probably benign 0.27
R7465:Atp2a2 UTSW 5 122461700 missense probably benign
R7489:Atp2a2 UTSW 5 122467767 missense probably benign
R7567:Atp2a2 UTSW 5 122491784 missense probably benign 0.29
R7729:Atp2a2 UTSW 5 122491766 missense probably benign 0.30
R7734:Atp2a2 UTSW 5 122458527 missense possibly damaging 0.95
R7739:Atp2a2 UTSW 5 122469705 missense probably damaging 0.98
R7743:Atp2a2 UTSW 5 122461571 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CAGTGTCACTATGCACATCCTG -3'
(R):5'- GGTTGAGCATTGTTCAGACTTCC -3'

Sequencing Primer
(F):5'- ACATCCTGCTGTTTGTTTATTCAGAG -3'
(R):5'- GAACTTTGTAAATCAGGCTGGCCTC -3'
Posted On2019-06-26