Mutagenetix > Incidental Mutation

Incidental Mutation 'R7268:Atp6v0a2'

565069

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R7268 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124719866 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 770 (L770P)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000197161] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037865
AA Change: L770P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: L770P

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197161

SMART Domains

Protein: ENSMUSP00000143461
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Meta Mutation Damage Score

0.9600

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
Abl2	T	C	1: 156,633,939		probably null	Het
Acsf3	A	G	8: 122,790,662	Y399C	probably benign	Het
Acsm5	A	T	7: 119,537,288	T361S	probably benign	Het
Agap1	T	G	1: 89,766,348	I456S	probably benign	Het
Ahnak2	A	T	12: 112,780,802	V70E		Het
Alb	T	A	5: 90,462,716	S52T	probably benign	Het
Ankle1	A	G	8: 71,407,545	T256A	probably damaging	Het
Armt1	G	A	10: 4,450,855	V201M	possibly damaging	Het
Atp2a2	T	C	5: 122,467,729	T388A	probably benign	Het
B4galnt3	A	T	6: 120,215,042	W578R	possibly damaging	Het
Babam2	T	C	5: 31,701,853	S2P	probably damaging	Het
Baz2a	A	G	10: 128,124,221	H1459R	possibly damaging	Het
Bbs7	C	T	3: 36,604,426	R233Q	probably benign	Het
Cacna2d1	G	A	5: 16,370,588	G1076R	probably damaging	Het
Camsap2	C	T	1: 136,273,745		probably null	Het
Car10	A	G	11: 93,599,251	N273D	probably benign	Het
Ccdc66	T	C	14: 27,486,923	D458G	probably benign	Het
Ccdc7a	T	A	8: 128,881,152	H982L	possibly damaging	Het
Col9a1	A	G	1: 24,207,398	K386E	possibly damaging	Het
Ctcfl	A	G	2: 173,107,795	I415T	probably benign	Het
Cyp3a16	G	C	5: 145,467,470	Y54*	probably null	Het
Dact2	T	C	17: 14,196,535	T468A	probably benign	Het
Dgkb	T	A	12: 38,147,555	L355*	probably null	Het
Dhx40	A	T	11: 86,806,616	C42S	possibly damaging	Het
Dopey1	G	T	9: 86,512,777	E637*	probably null	Het
Dpp4	G	T	2: 62,347,842	P649T	probably damaging	Het
Eri3	T	A	4: 117,649,383	I303K	probably benign	Het
Foxi1	A	T	11: 34,205,783	Y282*	probably null	Het
Gdi2	T	A	13: 3,556,363	Y146*	probably null	Het
Gns	A	G	10: 121,376,652	Y173C	probably damaging	Het
Gpc1	C	A	1: 92,858,371	P494Q	possibly damaging	Het
Habp2	G	T	19: 56,314,086	G274V	probably damaging	Het
Hcfc2	T	A	10: 82,709,012	Y159*	probably null	Het
Hmcn2	T	A	2: 31,457,966	S4875T	possibly damaging	Het
Hmgcs2	A	G	3: 98,297,480	N318S	probably benign	Het
Lnpep	A	T	17: 17,538,541	M847K	probably benign	Het
Mmp16	A	C	4: 18,093,366	M374L	probably benign	Het
Mrpl38	A	G	11: 116,138,570	I40T	possibly damaging	Het
Ncstn	T	C	1: 172,081,263	T46A	possibly damaging	Het
Nlrp1a	C	T	11: 71,124,242	V61I	probably benign	Het
Npas2	G	T	1: 39,287,577	V48L	probably damaging	Het
Olfr1339	A	G	4: 118,735,408	Y293C	probably damaging	Het
Olfr655	G	A	7: 104,597,077	L35F	probably benign	Het
Olfr782	C	T	10: 129,351,394	T277I	possibly damaging	Het
Pcyox1	A	T	6: 86,391,731	N268K	possibly damaging	Het
Pramef17	A	T	4: 143,993,520		probably null	Het
Prr27	T	C	5: 87,843,276	L249P	probably damaging	Het
Psat1	A	T	19: 15,917,144	V168D	probably damaging	Het
Psg17	G	T	7: 18,814,661	T395K	possibly damaging	Het
Ptgis	A	G	2: 167,206,756	Y447H	probably benign	Het
Rad50	T	A	11: 53,684,275	N607I	probably benign	Het
Rps6ka2	T	C	17: 7,295,263	Y602H	possibly damaging	Het
Senp6	G	A	9: 80,142,124	R1010H	probably damaging	Het
Slc8a3	C	A	12: 81,315,053	D331Y	probably damaging	Het
Slc9c1	G	A	16: 45,550,116	S240N	probably damaging	Het
Slf1	A	G	13: 77,066,707	L620P	probably damaging	Het
Snx19	A	G	9: 30,440,177	E847G	probably damaging	Het
Spaca6	T	C	17: 17,832,107	V103A	probably benign	Het
Tbk1	A	G	10: 121,552,499	Y591H	probably benign	Het
Tchh	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	3: 93,446,708		probably benign	Het
Tfap2a	G	A	13: 40,728,760	T15I	possibly damaging	Het
Tgm2	G	A	2: 158,120,268	R544*	probably null	Het
Tmem116	T	A	5: 121,467,855	I90K		Het
Tmem30c	A	C	16: 57,266,414	L342R	probably damaging	Het
Trpm6	C	T	19: 18,778,585	T64I	probably benign	Het
Ttll8	A	G	15: 88,934,956		probably null	Het
Vcpip1	A	G	1: 9,746,082	I692T	probably damaging	Het
Vmn1r169	T	G	7: 23,577,428	F82V	probably benign	Het
Vmn1r178	G	A	7: 23,893,953	C142Y	probably benign	Het
Vmn2r16	T	A	5: 109,340,465	Y401*	probably null	Het
Wdr91	A	G	6: 34,892,440	V383A	probably benign	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACAGGGTACTCGATCCAG -3'
(R):5'- TGTTCTGAGGACACACAGAGC -3'

Sequencing Primer
(F):5'- AGGGTACTCGATCCAGGTCTG -3'
(R):5'- TGAGGACACACAGAGCACTCAC -3'

Posted On

2019-06-26