Incidental Mutation 'R7268:Cyp3a16'
ID565070
Institutional Source Beutler Lab
Gene Symbol Cyp3a16
Ensembl Gene ENSMUSG00000038656
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145436309-145469723 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to C at 145467470 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 54 (Y54*)
Ref Sequence ENSEMBL: ENSMUSP00000031633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031633]
Predicted Effect probably null
Transcript: ENSMUST00000031633
AA Change: Y54*
SMART Domains Protein: ENSMUSP00000031633
Gene: ENSMUSG00000038656
AA Change: Y54*

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:p450 38 494 5.5e-132 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Cyp3a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Cyp3a16 APN 5 145440434 missense probably damaging 0.98
IGL01964:Cyp3a16 APN 5 145455562 missense probably benign 0.41
IGL02007:Cyp3a16 APN 5 145441948 splice site probably benign
IGL02139:Cyp3a16 APN 5 145455480 missense probably benign 0.10
IGL02177:Cyp3a16 APN 5 145450154 missense probably benign 0.43
IGL02407:Cyp3a16 APN 5 145451842 missense probably damaging 0.99
IGL02473:Cyp3a16 APN 5 145440494 missense possibly damaging 0.54
polywog UTSW 5 145467470 nonsense probably null
R0363:Cyp3a16 UTSW 5 145455879 splice site probably benign
R0556:Cyp3a16 UTSW 5 145455980 missense probably benign 0.37
R0557:Cyp3a16 UTSW 5 145469588 missense unknown
R0636:Cyp3a16 UTSW 5 145463085 missense probably benign 0.03
R0749:Cyp3a16 UTSW 5 145456177 critical splice acceptor site probably null
R0788:Cyp3a16 UTSW 5 145465076 missense probably benign 0.00
R1552:Cyp3a16 UTSW 5 145436536 missense probably benign 0.01
R1575:Cyp3a16 UTSW 5 145436457 missense probably benign 0.01
R1580:Cyp3a16 UTSW 5 145442074 missense possibly damaging 0.94
R1580:Cyp3a16 UTSW 5 145442075 missense probably damaging 1.00
R1642:Cyp3a16 UTSW 5 145469589 missense unknown
R1763:Cyp3a16 UTSW 5 145465031 critical splice donor site probably null
R2029:Cyp3a16 UTSW 5 145451857 missense probably damaging 0.96
R2144:Cyp3a16 UTSW 5 145456084 missense probably damaging 1.00
R2409:Cyp3a16 UTSW 5 145440367 missense probably benign 0.01
R2473:Cyp3a16 UTSW 5 145455594 missense possibly damaging 0.79
R2860:Cyp3a16 UTSW 5 145455499 nonsense probably null
R2861:Cyp3a16 UTSW 5 145455499 nonsense probably null
R3747:Cyp3a16 UTSW 5 145442071 missense probably damaging 1.00
R4654:Cyp3a16 UTSW 5 145436457 missense probably benign 0.01
R4781:Cyp3a16 UTSW 5 145456112 missense possibly damaging 0.85
R4873:Cyp3a16 UTSW 5 145452849 missense probably benign 0.01
R4875:Cyp3a16 UTSW 5 145452849 missense probably benign 0.01
R4925:Cyp3a16 UTSW 5 145452834 missense probably benign 0.00
R5365:Cyp3a16 UTSW 5 145452787 missense probably damaging 1.00
R5496:Cyp3a16 UTSW 5 145467531 missense probably damaging 1.00
R5640:Cyp3a16 UTSW 5 145452823 missense possibly damaging 0.94
R5761:Cyp3a16 UTSW 5 145442033 missense possibly damaging 0.79
R6401:Cyp3a16 UTSW 5 145440364 missense probably damaging 1.00
R6526:Cyp3a16 UTSW 5 145455895 missense probably benign 0.01
R6528:Cyp3a16 UTSW 5 145440431 missense probably damaging 1.00
R7000:Cyp3a16 UTSW 5 145463170 critical splice acceptor site probably null
R7630:Cyp3a16 UTSW 5 145436310 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCCAAACTCTGACCTCCTCATATG -3'
(R):5'- AGGAAGGAGCCCAGTTGTTG -3'

Sequencing Primer
(F):5'- TATTCACCTGCACACACATATGGG -3'
(R):5'- AAGGAGCCCAGTTGTTGATTTG -3'
Posted On2019-06-26