Incidental Mutation 'R7268:Acsm5'
ID 565078
Institutional Source Beutler Lab
Gene Symbol Acsm5
Ensembl Gene ENSMUSG00000030972
Gene Name acyl-CoA synthetase medium-chain family member 5
Synonyms C730027J19Rik
MMRRC Submission 045319-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R7268 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119125354-119142583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119136511 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 361 (T361S)
Ref Sequence ENSEMBL: ENSMUSP00000063416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066465] [ENSMUST00000207307] [ENSMUST00000207381] [ENSMUST00000207387] [ENSMUST00000207440] [ENSMUST00000207796] [ENSMUST00000207813]
AlphaFold Q8BGA8
Predicted Effect probably benign
Transcript: ENSMUST00000066465
AA Change: T361S

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000063416
Gene: ENSMUSG00000030972
AA Change: T361S

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
Pfam:AMP-binding 65 477 2.9e-78 PFAM
Pfam:AMP-binding_C 485 565 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207307
Predicted Effect probably benign
Transcript: ENSMUST00000207381
Predicted Effect probably benign
Transcript: ENSMUST00000207387
Predicted Effect probably benign
Transcript: ENSMUST00000207440
AA Change: T361S

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207796
AA Change: T361S

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000207813
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,461,509 (GRCm39) probably null Het
Acsf3 A G 8: 123,517,401 (GRCm39) Y399C probably benign Het
Agap1 T G 1: 89,694,070 (GRCm39) I456S probably benign Het
Ahnak2 A T 12: 112,780,802 (GRCm38) V70E Het
Alb T A 5: 90,610,575 (GRCm39) S52T probably benign Het
Ankle1 A G 8: 71,860,189 (GRCm39) T256A probably damaging Het
Armt1 G A 10: 4,400,855 (GRCm39) V201M possibly damaging Het
Atp2a2 T C 5: 122,605,792 (GRCm39) T388A probably benign Het
Atp6v0a2 T C 5: 124,796,930 (GRCm39) L770P probably damaging Het
B4galnt3 A T 6: 120,192,003 (GRCm39) W578R possibly damaging Het
Babam2 T C 5: 31,859,197 (GRCm39) S2P probably damaging Het
Baz2a A G 10: 127,960,090 (GRCm39) H1459R possibly damaging Het
Bbs7 C T 3: 36,658,575 (GRCm39) R233Q probably benign Het
Cacna2d1 G A 5: 16,575,586 (GRCm39) G1076R probably damaging Het
Camsap2 C T 1: 136,201,483 (GRCm39) probably null Het
Car10 A G 11: 93,490,077 (GRCm39) N273D probably benign Het
Ccdc66 T C 14: 27,208,880 (GRCm39) D458G probably benign Het
Ccdc7a T A 8: 129,607,633 (GRCm39) H982L possibly damaging Het
Col9a1 A G 1: 24,246,479 (GRCm39) K386E possibly damaging Het
Ctcfl A G 2: 172,949,588 (GRCm39) I415T probably benign Het
Cyp3a16 G C 5: 145,404,280 (GRCm39) Y54* probably null Het
Dact2 T C 17: 14,416,797 (GRCm39) T468A probably benign Het
Dgkb T A 12: 38,197,554 (GRCm39) L355* probably null Het
Dhx40 A T 11: 86,697,442 (GRCm39) C42S possibly damaging Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Dop1a G T 9: 86,394,830 (GRCm39) E637* probably null Het
Dpp4 G T 2: 62,178,186 (GRCm39) P649T probably damaging Het
Eri3 T A 4: 117,506,580 (GRCm39) I303K probably benign Het
Foxi1 A T 11: 34,155,783 (GRCm39) Y282* probably null Het
Gdi2 T A 13: 3,606,363 (GRCm39) Y146* probably null Het
Gns A G 10: 121,212,557 (GRCm39) Y173C probably damaging Het
Gpc1 C A 1: 92,786,093 (GRCm39) P494Q possibly damaging Het
Habp2 G T 19: 56,302,518 (GRCm39) G274V probably damaging Het
Hcfc2 T A 10: 82,544,846 (GRCm39) Y159* probably null Het
Hmcn2 T A 2: 31,347,978 (GRCm39) S4875T possibly damaging Het
Hmgcs2 A G 3: 98,204,796 (GRCm39) N318S probably benign Het
Lnpep A T 17: 17,758,803 (GRCm39) M847K probably benign Het
Mmp16 A C 4: 18,093,366 (GRCm39) M374L probably benign Het
Mrpl38 A G 11: 116,029,396 (GRCm39) I40T possibly damaging Het
Ncstn T C 1: 171,908,830 (GRCm39) T46A possibly damaging Het
Nlrp1a C T 11: 71,015,068 (GRCm39) V61I probably benign Het
Npas2 G T 1: 39,326,658 (GRCm39) V48L probably damaging Het
Or13p5 A G 4: 118,592,605 (GRCm39) Y293C probably damaging Het
Or52ac1 G A 7: 104,246,284 (GRCm39) L35F probably benign Het
Or6c6 C T 10: 129,187,263 (GRCm39) T277I possibly damaging Het
Pcyox1 A T 6: 86,368,713 (GRCm39) N268K possibly damaging Het
Pramel14 A T 4: 143,720,090 (GRCm39) probably null Het
Prr27 T C 5: 87,991,135 (GRCm39) L249P probably damaging Het
Psat1 A T 19: 15,894,508 (GRCm39) V168D probably damaging Het
Psg17 G T 7: 18,548,586 (GRCm39) T395K possibly damaging Het
Ptgis A G 2: 167,048,676 (GRCm39) Y447H probably benign Het
Rad50 T A 11: 53,575,102 (GRCm39) N607I probably benign Het
Rps6ka2 T C 17: 7,562,662 (GRCm39) Y602H possibly damaging Het
Senp6 G A 9: 80,049,406 (GRCm39) R1010H probably damaging Het
Slc8a3 C A 12: 81,361,827 (GRCm39) D331Y probably damaging Het
Slc9c1 G A 16: 45,370,479 (GRCm39) S240N probably damaging Het
Slf1 A G 13: 77,214,826 (GRCm39) L620P probably damaging Het
Snx19 A G 9: 30,351,473 (GRCm39) E847G probably damaging Het
Spaca6 T C 17: 18,052,369 (GRCm39) V103A probably benign Het
Tbk1 A G 10: 121,388,404 (GRCm39) Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,354,015 (GRCm39) probably benign Het
Tfap2a G A 13: 40,882,236 (GRCm39) T15I possibly damaging Het
Tgm2 G A 2: 157,962,188 (GRCm39) R544* probably null Het
Tmem116 T A 5: 121,605,918 (GRCm39) I90K Het
Tmem30c A C 16: 57,086,777 (GRCm39) L342R probably damaging Het
Trpm6 C T 19: 18,755,949 (GRCm39) T64I probably benign Het
Ttll8 A G 15: 88,819,159 (GRCm39) probably null Het
Vcpip1 A G 1: 9,816,307 (GRCm39) I692T probably damaging Het
Vmn1r169 T G 7: 23,276,853 (GRCm39) F82V probably benign Het
Vmn1r178 G A 7: 23,593,378 (GRCm39) C142Y probably benign Het
Vmn2r16 T A 5: 109,488,331 (GRCm39) Y401* probably null Het
Wdr91 A G 6: 34,869,375 (GRCm39) V383A probably benign Het
Other mutations in Acsm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Acsm5 APN 7 119,141,661 (GRCm39) critical splice donor site probably null
IGL01662:Acsm5 APN 7 119,137,511 (GRCm39) missense probably damaging 1.00
IGL02228:Acsm5 APN 7 119,131,089 (GRCm39) missense probably damaging 1.00
IGL02380:Acsm5 APN 7 119,136,509 (GRCm39) missense probably benign 0.05
IGL02709:Acsm5 APN 7 119,134,041 (GRCm39) nonsense probably null
P4717OSA:Acsm5 UTSW 7 119,131,195 (GRCm39) missense probably benign 0.12
R0506:Acsm5 UTSW 7 119,137,319 (GRCm39) nonsense probably null
R0518:Acsm5 UTSW 7 119,135,023 (GRCm39) missense possibly damaging 0.95
R0866:Acsm5 UTSW 7 119,140,123 (GRCm39) missense probably damaging 0.99
R1171:Acsm5 UTSW 7 119,140,075 (GRCm39) missense probably damaging 0.99
R2362:Acsm5 UTSW 7 119,127,649 (GRCm39) start gained probably benign
R2511:Acsm5 UTSW 7 119,129,677 (GRCm39) missense possibly damaging 0.80
R4670:Acsm5 UTSW 7 119,130,983 (GRCm39) splice site probably null
R4908:Acsm5 UTSW 7 119,137,314 (GRCm39) missense probably damaging 1.00
R4913:Acsm5 UTSW 7 119,133,566 (GRCm39) missense probably damaging 0.98
R5038:Acsm5 UTSW 7 119,134,034 (GRCm39) missense probably damaging 1.00
R5112:Acsm5 UTSW 7 119,136,502 (GRCm39) missense possibly damaging 0.95
R6337:Acsm5 UTSW 7 119,133,458 (GRCm39) missense probably benign 0.00
R6481:Acsm5 UTSW 7 119,134,104 (GRCm39) missense probably benign 0.02
R7275:Acsm5 UTSW 7 119,136,511 (GRCm39) missense possibly damaging 0.81
R7509:Acsm5 UTSW 7 119,133,611 (GRCm39) missense probably benign
R7794:Acsm5 UTSW 7 119,137,352 (GRCm39) unclassified probably benign
R8021:Acsm5 UTSW 7 119,141,616 (GRCm39) missense possibly damaging 0.72
R8178:Acsm5 UTSW 7 119,141,618 (GRCm39) missense probably damaging 1.00
R8797:Acsm5 UTSW 7 119,137,374 (GRCm39) missense probably damaging 1.00
Z1088:Acsm5 UTSW 7 119,136,434 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCACATGGAGTTGACTGTGG -3'
(R):5'- AGCATTCCCTACCAGTTTCAG -3'

Sequencing Primer
(F):5'- CTAGTGACTTAAGAGCTCTGGACC -3'
(R):5'- ACCAGTTTCAGTGCCCTAGAG -3'
Posted On 2019-06-26