Incidental Mutation 'R7268:Armt1'
ID565085
Institutional Source Beutler Lab
Gene Symbol Armt1
Ensembl Gene ENSMUSG00000061759
Gene Nameacidic residue methyltransferase 1
Synonyms1700052N19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location4432467-4455141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4450855 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 201 (V201M)
Ref Sequence ENSEMBL: ENSMUSP00000114073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095893] [ENSMUST00000118544] [ENSMUST00000152294]
Predicted Effect probably benign
Transcript: ENSMUST00000095893
SMART Domains Protein: ENSMUSP00000093581
Gene: ENSMUSG00000061759

DomainStartEndE-ValueType
Pfam:DUF89 20 417 1.3e-125 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118544
AA Change: V201M

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114073
Gene: ENSMUSG00000061759
AA Change: V201M

DomainStartEndE-ValueType
Pfam:DUF89 20 187 1.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152294
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Armt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Armt1 APN 10 4454051 missense possibly damaging 0.50
IGL01018:Armt1 APN 10 4450732 missense probably benign
IGL01018:Armt1 APN 10 4454237 unclassified probably benign
IGL02198:Armt1 APN 10 4454064 missense possibly damaging 0.95
IGL02980:Armt1 APN 10 4450643 splice site probably benign
IGL03104:Armt1 APN 10 4439615 missense possibly damaging 0.94
R0620:Armt1 UTSW 10 4432689 missense probably benign 0.38
R4248:Armt1 UTSW 10 4439687 missense probably benign 0.00
R5709:Armt1 UTSW 10 4434903 missense probably damaging 0.97
R6058:Armt1 UTSW 10 4453488 missense probably damaging 1.00
R6318:Armt1 UTSW 10 4450859 missense probably benign 0.01
R6410:Armt1 UTSW 10 4453826 missense probably benign
R6998:Armt1 UTSW 10 4453937 missense probably benign 0.03
R7242:Armt1 UTSW 10 4453475 missense probably damaging 1.00
R7432:Armt1 UTSW 10 4432706 missense probably benign 0.00
R7640:Armt1 UTSW 10 4453572 missense probably damaging 0.97
R7715:Armt1 UTSW 10 4450751 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAGAACTTCTTCGAGTCGC -3'
(R):5'- CCTCCCCTTTAGGATATGTATGGG -3'

Sequencing Primer
(F):5'- AACTTCTTCGAGTCGCAGGGC -3'
(R):5'- CCCTTTAGGATATGTATGGGACAAAG -3'
Posted On2019-06-26