Incidental Mutation 'R7268:Olfr782'
ID565090
Institutional Source Beutler Lab
Gene Symbol Olfr782
Ensembl Gene ENSMUSG00000095075
Gene Nameolfactory receptor 782
SynonymsMOR110-8, GA_x6K02T2PULF-11031172-11032116
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129348850-129352144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129351394 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 277 (T277I)
Ref Sequence ENSEMBL: ENSMUSP00000150951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077024] [ENSMUST00000213970]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077024
AA Change: T277I

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076282
Gene: ENSMUSG00000095075
AA Change: T277I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1e-48 PFAM
Pfam:7tm_1 39 288 8.5e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213970
AA Change: T277I

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Olfr782
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Olfr782 APN 10 129350650 missense probably damaging 1.00
IGL01469:Olfr782 APN 10 129350580 missense probably benign
IGL01980:Olfr782 APN 10 129351517 utr 3 prime probably benign
IGL03309:Olfr782 APN 10 129351309 missense probably benign 0.01
R0449:Olfr782 UTSW 10 129351234 missense probably benign 0.00
R1994:Olfr782 UTSW 10 129350692 missense probably damaging 1.00
R3121:Olfr782 UTSW 10 129350683 missense possibly damaging 0.74
R6421:Olfr782 UTSW 10 129351501 nonsense probably null
R7399:Olfr782 UTSW 10 129350557 start gained probably benign
R7647:Olfr782 UTSW 10 129351457 missense probably benign
X0027:Olfr782 UTSW 10 129351333 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACTGGTACTAGTGAGTCTC -3'
(R):5'- TGTGTGAAATAACTGCTGACATAGG -3'

Sequencing Primer
(F):5'- ACTGGTACTAGTGAGTCTCTCTTAC -3'
(R):5'- AAACCTCAGCATGATTTTGTTCTC -3'
Posted On2019-06-26