Mutagenetix > Incidental Mutation

Incidental Mutation 'R7268:Slc8a3'

565098

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

045319-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7268 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 81315053 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 331 (D331Y)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: D331Y

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: D331Y

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: D331Y

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182208
AA Change: D331Y

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: D331Y

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Meta Mutation Damage Score

0.1638

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
Abl2	T	C	1: 156,633,939		probably null	Het
Acsf3	A	G	8: 122,790,662	Y399C	probably benign	Het
Acsm5	A	T	7: 119,537,288	T361S	probably benign	Het
Agap1	T	G	1: 89,766,348	I456S	probably benign	Het
Ahnak2	A	T	12: 112,780,802	V70E		Het
Alb	T	A	5: 90,462,716	S52T	probably benign	Het
Ankle1	A	G	8: 71,407,545	T256A	probably damaging	Het
Armt1	G	A	10: 4,450,855	V201M	possibly damaging	Het
Atp2a2	T	C	5: 122,467,729	T388A	probably benign	Het
Atp6v0a2	T	C	5: 124,719,866	L770P	probably damaging	Het
B4galnt3	A	T	6: 120,215,042	W578R	possibly damaging	Het
Babam2	T	C	5: 31,701,853	S2P	probably damaging	Het
Baz2a	A	G	10: 128,124,221	H1459R	possibly damaging	Het
Bbs7	C	T	3: 36,604,426	R233Q	probably benign	Het
Cacna2d1	G	A	5: 16,370,588	G1076R	probably damaging	Het
Camsap2	C	T	1: 136,273,745		probably null	Het
Car10	A	G	11: 93,599,251	N273D	probably benign	Het
Ccdc66	T	C	14: 27,486,923	D458G	probably benign	Het
Ccdc7a	T	A	8: 128,881,152	H982L	possibly damaging	Het
Col9a1	A	G	1: 24,207,398	K386E	possibly damaging	Het
Ctcfl	A	G	2: 173,107,795	I415T	probably benign	Het
Cyp3a16	G	C	5: 145,467,470	Y54*	probably null	Het
Dact2	T	C	17: 14,196,535	T468A	probably benign	Het
Dgkb	T	A	12: 38,147,555	L355*	probably null	Het
Dhx40	A	T	11: 86,806,616	C42S	possibly damaging	Het
Dopey1	G	T	9: 86,512,777	E637*	probably null	Het
Dpp4	G	T	2: 62,347,842	P649T	probably damaging	Het
Eri3	T	A	4: 117,649,383	I303K	probably benign	Het
Foxi1	A	T	11: 34,205,783	Y282*	probably null	Het
Gdi2	T	A	13: 3,556,363	Y146*	probably null	Het
Gns	A	G	10: 121,376,652	Y173C	probably damaging	Het
Gpc1	C	A	1: 92,858,371	P494Q	possibly damaging	Het
Habp2	G	T	19: 56,314,086	G274V	probably damaging	Het
Hcfc2	T	A	10: 82,709,012	Y159*	probably null	Het
Hmcn2	T	A	2: 31,457,966	S4875T	possibly damaging	Het
Hmgcs2	A	G	3: 98,297,480	N318S	probably benign	Het
Lnpep	A	T	17: 17,538,541	M847K	probably benign	Het
Mmp16	A	C	4: 18,093,366	M374L	probably benign	Het
Mrpl38	A	G	11: 116,138,570	I40T	possibly damaging	Het
Ncstn	T	C	1: 172,081,263	T46A	possibly damaging	Het
Nlrp1a	C	T	11: 71,124,242	V61I	probably benign	Het
Npas2	G	T	1: 39,287,577	V48L	probably damaging	Het
Olfr1339	A	G	4: 118,735,408	Y293C	probably damaging	Het
Olfr655	G	A	7: 104,597,077	L35F	probably benign	Het
Olfr782	C	T	10: 129,351,394	T277I	possibly damaging	Het
Pcyox1	A	T	6: 86,391,731	N268K	possibly damaging	Het
Pramef17	A	T	4: 143,993,520		probably null	Het
Prr27	T	C	5: 87,843,276	L249P	probably damaging	Het
Psat1	A	T	19: 15,917,144	V168D	probably damaging	Het
Psg17	G	T	7: 18,814,661	T395K	possibly damaging	Het
Ptgis	A	G	2: 167,206,756	Y447H	probably benign	Het
Rad50	T	A	11: 53,684,275	N607I	probably benign	Het
Rps6ka2	T	C	17: 7,295,263	Y602H	possibly damaging	Het
Senp6	G	A	9: 80,142,124	R1010H	probably damaging	Het
Slc9c1	G	A	16: 45,550,116	S240N	probably damaging	Het
Slf1	A	G	13: 77,066,707	L620P	probably damaging	Het
Snx19	A	G	9: 30,440,177	E847G	probably damaging	Het
Spaca6	T	C	17: 17,832,107	V103A	probably benign	Het
Tbk1	A	G	10: 121,552,499	Y591H	probably benign	Het
Tchh	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	3: 93,446,708		probably benign	Het
Tfap2a	G	A	13: 40,728,760	T15I	possibly damaging	Het
Tgm2	G	A	2: 158,120,268	R544*	probably null	Het
Tmem116	T	A	5: 121,467,855	I90K		Het
Tmem30c	A	C	16: 57,266,414	L342R	probably damaging	Het
Trpm6	C	T	19: 18,778,585	T64I	probably benign	Het
Ttll8	A	G	15: 88,934,956		probably null	Het
Vcpip1	A	G	1: 9,746,082	I692T	probably damaging	Het
Vmn1r169	T	G	7: 23,577,428	F82V	probably benign	Het
Vmn1r178	G	A	7: 23,893,953	C142Y	probably benign	Het
Vmn2r16	T	A	5: 109,340,465	Y401*	probably null	Het
Wdr91	A	G	6: 34,892,440	V383A	probably benign	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TATGCACCTCGCTCATGCTG -3'
(R):5'- ACTGCTCTTCTACAAATACATGCAC -3'

Sequencing Primer
(F):5'- CGCTCATGCTGGAGGTCTTC -3'
(R):5'- CACCGAGGAATTATCATTGAGAC -3'

Posted On

2019-06-26