Incidental Mutation 'R7268:Gdi2'
ID565100
Institutional Source Beutler Lab
Gene Symbol Gdi2
Ensembl Gene ENSMUSG00000021218
Gene Nameguanosine diphosphate (GDP) dissociation inhibitor 2
SynonymsGDIB, Gdi3, GDI beta, GDI-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location3538063-3567871 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 3556363 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 146 (Y146*)
Ref Sequence ENSEMBL: ENSMUSP00000152454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059515] [ENSMUST00000222365] [ENSMUST00000223396]
Predicted Effect probably null
Transcript: ENSMUST00000059515
AA Change: Y110*
SMART Domains Protein: ENSMUSP00000062996
Gene: ENSMUSG00000021218
AA Change: Y110*

DomainStartEndE-ValueType
Pfam:GDI 1 436 4.6e-239 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000222365
AA Change: Y136*
Predicted Effect probably null
Transcript: ENSMUST00000223396
AA Change: Y146*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI2 is ubiquitously expressed. The GDI2 gene contains many repetitive elements indicating that it may be prone to inversion/deletion rearrangements. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Gdi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Gdi2 APN 13 3556467 missense probably benign 0.04
IGL01135:Gdi2 APN 13 3548855 splice site probably benign
IGL01402:Gdi2 APN 13 3564611 missense probably benign 0.24
IGL01404:Gdi2 APN 13 3564611 missense probably benign 0.24
IGL02100:Gdi2 APN 13 3556373 missense probably benign 0.03
IGL02305:Gdi2 APN 13 3556428 missense probably damaging 1.00
IGL02545:Gdi2 APN 13 3557009 missense probably damaging 1.00
IGL02561:Gdi2 APN 13 3548954 missense possibly damaging 0.94
IGL02939:Gdi2 APN 13 3564623 missense probably benign 0.21
E0354:Gdi2 UTSW 13 3561939 unclassified probably null
R1612:Gdi2 UTSW 13 3560051 missense probably benign 0.00
R1775:Gdi2 UTSW 13 3560018 missense possibly damaging 0.71
R1803:Gdi2 UTSW 13 3564547 nonsense probably null
R2254:Gdi2 UTSW 13 3554400 splice site probably null
R2426:Gdi2 UTSW 13 3562034 missense probably benign 0.17
R4081:Gdi2 UTSW 13 3548866 missense probably benign 0.10
R6365:Gdi2 UTSW 13 3565093 missense possibly damaging 0.82
R7130:Gdi2 UTSW 13 3548891 missense probably benign 0.12
R7349:Gdi2 UTSW 13 3556395 missense probably benign 0.16
R7590:Gdi2 UTSW 13 3564611 missense probably benign 0.24
R7753:Gdi2 UTSW 13 3548956 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGCTGTGCAATTGAGTGC -3'
(R):5'- TCTGCACAGCTAGGTGATGAG -3'

Sequencing Primer
(F):5'- GCAATTGAGTGCTGTGAATGATC -3'
(R):5'- GATGAGAGCCATTAGCCTACTTACTC -3'
Posted On2019-06-26