Incidental Mutation 'R7268:Tfap2a'
ID565101
Institutional Source Beutler Lab
Gene Symbol Tfap2a
Ensembl Gene ENSMUSG00000021359
Gene Nametranscription factor AP-2, alpha
SynonymsTcfap2a, Ap2, Ap-2 (a), AP-2 alpha, Ap2tf, AP2alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location40715302-40738376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40728760 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 15 (T15I)
Ref Sequence ENSEMBL: ENSMUSP00000021787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021787] [ENSMUST00000110193] [ENSMUST00000223869] [ENSMUST00000224665] [ENSMUST00000224999] [ENSMUST00000225180]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021787
AA Change: T15I

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021787
Gene: ENSMUSG00000021359
AA Change: T15I

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
low complexity region 82 95 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
Pfam:TF_AP-2 201 408 1.6e-103 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110193
AA Change: T21I

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105822
Gene: ENSMUSG00000021359
AA Change: T21I

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
low complexity region 88 101 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
Pfam:TF_AP-2 209 409 7.8e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000223869
AA Change: T17I

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224665
AA Change: T23I

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224999
AA Change: T23I

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000225180
AA Change: T50I

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: This gene is a member of the activator protein 2 (AP-2) transcription factor family. The protein encoded by this gene can act as both an activator and repressor of gene transcription, and plays an important role in early embryogenesis, specifically in cranial development. This protein forms both homodimers and heterodimers, and binds to a GC-rich consensus sequence found in some promoters and enhancers. Disruption of this gene causes perinatal death, with neural tube, craniofacial, and limb mesenchyme defects. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mutants die perinatally with anencephaly, craniofacial and neural tube defects, thoraco-abdominoschisis and defects in sensory organs, cranial ganglia, skeleton, and heart. On some genetic backgrounds, heterozygotes may exhibit exencephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Tfap2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4366001:Tfap2a UTSW 13 40721374 missense possibly damaging 0.67
R0124:Tfap2a UTSW 13 40717411 splice site probably benign
R0400:Tfap2a UTSW 13 40717412 splice site probably benign
R0486:Tfap2a UTSW 13 40728694 missense probably damaging 1.00
R1132:Tfap2a UTSW 13 40721391 splice site probably null
R1418:Tfap2a UTSW 13 40717204 missense possibly damaging 0.89
R1751:Tfap2a UTSW 13 40725137 missense probably damaging 1.00
R1767:Tfap2a UTSW 13 40725137 missense probably damaging 1.00
R1802:Tfap2a UTSW 13 40725170 missense probably damaging 1.00
R1865:Tfap2a UTSW 13 40728408 missense probably damaging 1.00
R4913:Tfap2a UTSW 13 40717230 missense probably damaging 1.00
R5764:Tfap2a UTSW 13 40728355 missense possibly damaging 0.64
R6378:Tfap2a UTSW 13 40723241 missense possibly damaging 0.48
R6496:Tfap2a UTSW 13 40728775 missense probably damaging 1.00
R6751:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6773:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6774:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6786:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R7027:Tfap2a UTSW 13 40733674 missense probably benign 0.02
R7140:Tfap2a UTSW 13 40730047 missense probably benign 0.19
R7299:Tfap2a UTSW 13 40721308 missense probably damaging 1.00
R7301:Tfap2a UTSW 13 40721308 missense probably damaging 1.00
R7689:Tfap2a UTSW 13 40728575 missense probably damaging 1.00
R7761:Tfap2a UTSW 13 40725180 missense probably benign 0.12
R8005:Tfap2a UTSW 13 40719208 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CGTTGACGTGGGAGTAAGGATC -3'
(R):5'- TCCCTGAGAGTCTACTGTGC -3'

Sequencing Primer
(F):5'- AGTAAGGATCTTGCGACTGG -3'
(R):5'- TTGGAAAGGCCTGCTTCAC -3'
Posted On2019-06-26