Incidental Mutation 'R7268:Slf1'
ID565102
Institutional Source Beutler Lab
Gene Symbol Slf1
Ensembl Gene ENSMUSG00000021597
Gene NameSMC5-SMC6 complex localization factor 1
Synonyms2700017A04Rik, Brctx, Brctd1, C730024G01Rik, Ankrd32
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location77043088-77135473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77066707 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 620 (L620P)
Ref Sequence ENSEMBL: ENSMUSP00000118312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151524]
Predicted Effect probably damaging
Transcript: ENSMUST00000151524
AA Change: L620P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597
AA Change: L620P

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
low complexity region 527 541 N/A INTRINSIC
low complexity region 765 785 N/A INTRINSIC
ANK 802 832 1.52e0 SMART
ANK 836 865 4.32e-5 SMART
ANK 870 900 2.07e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Slf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slf1 APN 13 77043947 missense possibly damaging 0.95
IGL01105:Slf1 APN 13 77100912 unclassified probably benign
IGL01108:Slf1 APN 13 77125475 splice site probably benign
IGL01149:Slf1 APN 13 77112648 missense probably damaging 0.99
IGL01642:Slf1 APN 13 77049915 missense probably benign 0.00
IGL01757:Slf1 APN 13 77084440 missense probably benign
IGL01887:Slf1 APN 13 77100982 missense probably benign 0.02
IGL02323:Slf1 APN 13 77051294 missense possibly damaging 0.87
IGL02861:Slf1 APN 13 77126359 splice site probably benign
IGL02971:Slf1 APN 13 77047104 splice site probably benign
IGL03088:Slf1 APN 13 77084435 missense probably damaging 1.00
IGL03215:Slf1 APN 13 77049977 missense probably benign 0.00
IGL02980:Slf1 UTSW 13 77044004 missense possibly damaging 0.92
PIT1430001:Slf1 UTSW 13 77050050 splice site probably benign
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0125:Slf1 UTSW 13 77043745 missense probably benign 0.02
R0230:Slf1 UTSW 13 77112748 intron probably benign
R0244:Slf1 UTSW 13 77126632 nonsense probably null
R0395:Slf1 UTSW 13 77105969 splice site probably benign
R0614:Slf1 UTSW 13 77049114 missense probably benign 0.10
R0661:Slf1 UTSW 13 77083596 missense probably benign 0.31
R0837:Slf1 UTSW 13 77100948 unclassified probably null
R0945:Slf1 UTSW 13 77103471 unclassified probably benign
R1282:Slf1 UTSW 13 77043840 missense probably damaging 0.97
R1365:Slf1 UTSW 13 77126371 missense probably damaging 1.00
R1449:Slf1 UTSW 13 77083449 missense probably damaging 1.00
R1646:Slf1 UTSW 13 77066648 nonsense probably null
R2071:Slf1 UTSW 13 77104624 missense probably benign 0.02
R2141:Slf1 UTSW 13 77049219 critical splice acceptor site probably null
R2217:Slf1 UTSW 13 77046706 critical splice acceptor site probably null
R2397:Slf1 UTSW 13 77103583 nonsense probably null
R2520:Slf1 UTSW 13 77051265 missense probably damaging 1.00
R3108:Slf1 UTSW 13 77126721 splice site probably benign
R4178:Slf1 UTSW 13 77043569 missense probably damaging 1.00
R4663:Slf1 UTSW 13 77126604 missense probably damaging 1.00
R4730:Slf1 UTSW 13 77046632 missense probably damaging 1.00
R4910:Slf1 UTSW 13 77043880 missense probably benign 0.14
R4912:Slf1 UTSW 13 77051294 missense probably damaging 1.00
R5122:Slf1 UTSW 13 77049987 missense probably benign 0.01
R5269:Slf1 UTSW 13 77104581 missense probably benign 0.33
R5336:Slf1 UTSW 13 77106010 makesense probably null
R5346:Slf1 UTSW 13 77092371 missense probably benign 0.00
R5445:Slf1 UTSW 13 77091204 missense probably benign 0.10
R5568:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R5622:Slf1 UTSW 13 77049971 missense probably benign 0.14
R5685:Slf1 UTSW 13 77083479 missense possibly damaging 0.88
R5792:Slf1 UTSW 13 77066737 missense probably benign 0.03
R5856:Slf1 UTSW 13 77106087 missense possibly damaging 0.63
R6109:Slf1 UTSW 13 77126680 missense probably damaging 0.99
R6245:Slf1 UTSW 13 77084383 missense probably damaging 1.00
R6338:Slf1 UTSW 13 77084462 critical splice acceptor site probably null
R6438:Slf1 UTSW 13 77066606 missense probably damaging 1.00
R6487:Slf1 UTSW 13 77066617 missense probably damaging 1.00
R6597:Slf1 UTSW 13 77049129 missense probably benign 0.01
R6600:Slf1 UTSW 13 77083536 missense probably benign 0.00
R6661:Slf1 UTSW 13 77043845 missense probably damaging 1.00
R7308:Slf1 UTSW 13 77051168 missense probably benign 0.19
R7355:Slf1 UTSW 13 77091303 missense probably damaging 1.00
R7546:Slf1 UTSW 13 77049192 missense probably benign
X0018:Slf1 UTSW 13 77051238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGCATTATAGAATTTCCCATTCC -3'
(R):5'- CAGATTTCCAGCATTGTGGTG -3'

Sequencing Primer
(F):5'- CTGAAGAATAGACCACTTAAAGGTAC -3'
(R):5'- CCAGCATTGTGGTGTATGTAATGAG -3'
Posted On2019-06-26