Incidental Mutation 'R7268:Slc9c1'
ID565105
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45550116 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 240 (S240N)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect probably damaging
Transcript: ENSMUST00000159945
AA Change: S240N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: S240N

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAAGGGATACTTGTACTCTGATGTTC -3'
(R):5'- TTCTCTGTGTAACAGTGTGCAC -3'

Sequencing Primer
(F):5'- ACTCTGATGTTCATTTTAACAGAGC -3'
(R):5'- CATAGTTATCTGTTCTTTGCCGG -3'
Posted On2019-06-26