Incidental Mutation 'R7268:Slc9c1'
ID 565105
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 045319-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R7268 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 45370479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 240 (S240N)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably damaging
Transcript: ENSMUST00000159945
AA Change: S240N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: S240N

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,461,509 (GRCm39) probably null Het
Acsf3 A G 8: 123,517,401 (GRCm39) Y399C probably benign Het
Acsm5 A T 7: 119,136,511 (GRCm39) T361S probably benign Het
Agap1 T G 1: 89,694,070 (GRCm39) I456S probably benign Het
Ahnak2 A T 12: 112,780,802 (GRCm38) V70E Het
Alb T A 5: 90,610,575 (GRCm39) S52T probably benign Het
Ankle1 A G 8: 71,860,189 (GRCm39) T256A probably damaging Het
Armt1 G A 10: 4,400,855 (GRCm39) V201M possibly damaging Het
Atp2a2 T C 5: 122,605,792 (GRCm39) T388A probably benign Het
Atp6v0a2 T C 5: 124,796,930 (GRCm39) L770P probably damaging Het
B4galnt3 A T 6: 120,192,003 (GRCm39) W578R possibly damaging Het
Babam2 T C 5: 31,859,197 (GRCm39) S2P probably damaging Het
Baz2a A G 10: 127,960,090 (GRCm39) H1459R possibly damaging Het
Bbs7 C T 3: 36,658,575 (GRCm39) R233Q probably benign Het
Cacna2d1 G A 5: 16,575,586 (GRCm39) G1076R probably damaging Het
Camsap2 C T 1: 136,201,483 (GRCm39) probably null Het
Car10 A G 11: 93,490,077 (GRCm39) N273D probably benign Het
Ccdc66 T C 14: 27,208,880 (GRCm39) D458G probably benign Het
Ccdc7a T A 8: 129,607,633 (GRCm39) H982L possibly damaging Het
Col9a1 A G 1: 24,246,479 (GRCm39) K386E possibly damaging Het
Ctcfl A G 2: 172,949,588 (GRCm39) I415T probably benign Het
Cyp3a16 G C 5: 145,404,280 (GRCm39) Y54* probably null Het
Dact2 T C 17: 14,416,797 (GRCm39) T468A probably benign Het
Dgkb T A 12: 38,197,554 (GRCm39) L355* probably null Het
Dhx40 A T 11: 86,697,442 (GRCm39) C42S possibly damaging Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Dop1a G T 9: 86,394,830 (GRCm39) E637* probably null Het
Dpp4 G T 2: 62,178,186 (GRCm39) P649T probably damaging Het
Eri3 T A 4: 117,506,580 (GRCm39) I303K probably benign Het
Foxi1 A T 11: 34,155,783 (GRCm39) Y282* probably null Het
Gdi2 T A 13: 3,606,363 (GRCm39) Y146* probably null Het
Gns A G 10: 121,212,557 (GRCm39) Y173C probably damaging Het
Gpc1 C A 1: 92,786,093 (GRCm39) P494Q possibly damaging Het
Habp2 G T 19: 56,302,518 (GRCm39) G274V probably damaging Het
Hcfc2 T A 10: 82,544,846 (GRCm39) Y159* probably null Het
Hmcn2 T A 2: 31,347,978 (GRCm39) S4875T possibly damaging Het
Hmgcs2 A G 3: 98,204,796 (GRCm39) N318S probably benign Het
Lnpep A T 17: 17,758,803 (GRCm39) M847K probably benign Het
Mmp16 A C 4: 18,093,366 (GRCm39) M374L probably benign Het
Mrpl38 A G 11: 116,029,396 (GRCm39) I40T possibly damaging Het
Ncstn T C 1: 171,908,830 (GRCm39) T46A possibly damaging Het
Nlrp1a C T 11: 71,015,068 (GRCm39) V61I probably benign Het
Npas2 G T 1: 39,326,658 (GRCm39) V48L probably damaging Het
Or13p5 A G 4: 118,592,605 (GRCm39) Y293C probably damaging Het
Or52ac1 G A 7: 104,246,284 (GRCm39) L35F probably benign Het
Or6c6 C T 10: 129,187,263 (GRCm39) T277I possibly damaging Het
Pcyox1 A T 6: 86,368,713 (GRCm39) N268K possibly damaging Het
Pramel14 A T 4: 143,720,090 (GRCm39) probably null Het
Prr27 T C 5: 87,991,135 (GRCm39) L249P probably damaging Het
Psat1 A T 19: 15,894,508 (GRCm39) V168D probably damaging Het
Psg17 G T 7: 18,548,586 (GRCm39) T395K possibly damaging Het
Ptgis A G 2: 167,048,676 (GRCm39) Y447H probably benign Het
Rad50 T A 11: 53,575,102 (GRCm39) N607I probably benign Het
Rps6ka2 T C 17: 7,562,662 (GRCm39) Y602H possibly damaging Het
Senp6 G A 9: 80,049,406 (GRCm39) R1010H probably damaging Het
Slc8a3 C A 12: 81,361,827 (GRCm39) D331Y probably damaging Het
Slf1 A G 13: 77,214,826 (GRCm39) L620P probably damaging Het
Snx19 A G 9: 30,351,473 (GRCm39) E847G probably damaging Het
Spaca6 T C 17: 18,052,369 (GRCm39) V103A probably benign Het
Tbk1 A G 10: 121,388,404 (GRCm39) Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,354,015 (GRCm39) probably benign Het
Tfap2a G A 13: 40,882,236 (GRCm39) T15I possibly damaging Het
Tgm2 G A 2: 157,962,188 (GRCm39) R544* probably null Het
Tmem116 T A 5: 121,605,918 (GRCm39) I90K Het
Tmem30c A C 16: 57,086,777 (GRCm39) L342R probably damaging Het
Trpm6 C T 19: 18,755,949 (GRCm39) T64I probably benign Het
Ttll8 A G 15: 88,819,159 (GRCm39) probably null Het
Vcpip1 A G 1: 9,816,307 (GRCm39) I692T probably damaging Het
Vmn1r169 T G 7: 23,276,853 (GRCm39) F82V probably benign Het
Vmn1r178 G A 7: 23,593,378 (GRCm39) C142Y probably benign Het
Vmn2r16 T A 5: 109,488,331 (GRCm39) Y401* probably null Het
Wdr91 A G 6: 34,869,375 (GRCm39) V383A probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAAGGGATACTTGTACTCTGATGTTC -3'
(R):5'- TTCTCTGTGTAACAGTGTGCAC -3'

Sequencing Primer
(F):5'- ACTCTGATGTTCATTTTAACAGAGC -3'
(R):5'- CATAGTTATCTGTTCTTTGCCGG -3'
Posted On 2019-06-26