Incidental Mutation 'R7268:Habp2'
ID565113
Institutional Source Beutler Lab
Gene Symbol Habp2
Ensembl Gene ENSMUSG00000025075
Gene Namehyaluronic acid binding protein 2
SynonymsFSAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location56287137-56320822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56314086 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 274 (G274V)
Ref Sequence ENSEMBL: ENSMUSP00000093641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078284] [ENSMUST00000095948] [ENSMUST00000163502] [ENSMUST00000165522] [ENSMUST00000166049] [ENSMUST00000171341]
Predicted Effect probably damaging
Transcript: ENSMUST00000078284
AA Change: G311V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077402
Gene: ENSMUSG00000025075
AA Change: G311V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Tryp_SPc 307 544 1.47e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095948
AA Change: G274V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093641
Gene: ENSMUSG00000025075
AA Change: G274V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 33 66 4.66e-6 SMART
EGF 71 105 3.97e0 SMART
EGF 110 145 2.26e-4 SMART
KR 149 235 2.72e-39 SMART
Tryp_SPc 270 507 1.47e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163502
AA Change: G80V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128964
Gene: ENSMUSG00000025075
AA Change: G80V

DomainStartEndE-ValueType
KR 1 41 5.87e-6 SMART
Tryp_SPc 76 220 5.6e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165522
AA Change: G44V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130809
Gene: ENSMUSG00000025075
AA Change: G44V

DomainStartEndE-ValueType
Pfam:Trypsin 41 106 6.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166049
AA Change: G306V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132444
Gene: ENSMUSG00000025075
AA Change: G306V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Tryp_SPc 302 539 1.47e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171341
SMART Domains Protein: ENSMUSP00000126235
Gene: ENSMUSG00000025075

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by hepatocytes and proteolytically processed to generate heavy and light chains that form the mature heterodimer. Further autoproteolysis leads to smaller, inactive peptides. This extracellular protease binds hyaluronic acid and may play a role in the coagulation and fibrinolysis systems. Mutations in this gene are associated with nonmedullary thyroid cancer and susceptibility to venous thromboembolism. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased lethality but increased liver fibrosis, inflammation and injury following bile duct ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Habp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Habp2 APN 19 56317832 missense probably damaging 1.00
IGL01113:Habp2 APN 19 56310116 missense probably benign 0.13
IGL01737:Habp2 APN 19 56316307 missense probably benign 0.00
IGL02174:Habp2 APN 19 56311737 missense probably damaging 0.96
IGL02250:Habp2 APN 19 56308929 missense probably benign 0.00
IGL02706:Habp2 APN 19 56310138 critical splice donor site probably null
IGL02953:Habp2 APN 19 56314232 critical splice donor site probably null
IGL02986:Habp2 APN 19 56311192 missense probably benign 0.25
IGL03010:Habp2 APN 19 56311223 critical splice donor site probably null
R0415:Habp2 UTSW 19 56317717 unclassified probably benign
R0483:Habp2 UTSW 19 56316432 unclassified probably benign
R0627:Habp2 UTSW 19 56314046 missense probably damaging 1.00
R1188:Habp2 UTSW 19 56311722 missense probably benign 0.39
R1880:Habp2 UTSW 19 56317828 missense possibly damaging 0.83
R2214:Habp2 UTSW 19 56317817 missense possibly damaging 0.88
R2473:Habp2 UTSW 19 56288032 missense possibly damaging 0.92
R2869:Habp2 UTSW 19 56287991 unclassified probably benign
R2871:Habp2 UTSW 19 56287991 unclassified probably benign
R3917:Habp2 UTSW 19 56311179 missense probably damaging 1.00
R3969:Habp2 UTSW 19 56311701 missense probably damaging 1.00
R4014:Habp2 UTSW 19 56319622 missense probably benign 0.04
R4853:Habp2 UTSW 19 56311191 unclassified probably null
R5835:Habp2 UTSW 19 56306786 missense probably benign 0.16
R6270:Habp2 UTSW 19 56306863 missense possibly damaging 0.93
R6390:Habp2 UTSW 19 56306823 missense possibly damaging 0.63
R7110:Habp2 UTSW 19 56311164 nonsense probably null
R7456:Habp2 UTSW 19 56319525 missense probably damaging 1.00
R7583:Habp2 UTSW 19 56311804 missense probably benign 0.03
R8021:Habp2 UTSW 19 56314053 missense probably benign 0.04
Z1176:Habp2 UTSW 19 56317760 missense probably damaging 1.00
Z1177:Habp2 UTSW 19 56319553 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGCTATGTCCTCCAAAGG -3'
(R):5'- CCTGCCAAAACTTCTGAGGTG -3'

Sequencing Primer
(F):5'- CTCCAAAGGAACGGCTTGTGTG -3'
(R):5'- CCAAAACTTCTGAGGTGTCACTTGG -3'
Posted On2019-06-26