Incidental Mutation 'R7269:Scn2a'
ID565116
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Namesodium channel, voltage-gated, type II, alpha
SynonymsA230052E19Rik, Scn2a1, Nav1.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7269 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location65620771-65767447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65763769 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1654 (L1654Q)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
Predicted Effect probably damaging
Transcript: ENSMUST00000028377
AA Change: L1654Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: L1654Q

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100067
AA Change: L1654Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: L1654Q

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200829
AA Change: L1654Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: L1654Q

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A T 18: 24,472,956 N36I probably damaging Het
A430033K04Rik T A 5: 138,646,752 Y300N possibly damaging Het
Adipor2 T C 6: 119,370,244 Q26R probably benign Het
Ahnak T A 19: 9,006,617 M1755K probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
AI837181 C A 19: 5,426,434 S208R probably damaging Het
Akap2 G T 4: 57,855,217 R182L probably damaging Het
Arhgap35 T G 7: 16,561,727 M1138L probably benign Het
Card14 T G 11: 119,337,747 L633R probably damaging Het
Carmil3 A G 14: 55,493,895 T144A probably benign Het
Cbfa2t2 T A 2: 154,515,975 N223K probably benign Het
Ccdc39 T C 3: 33,830,105 I363V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccpg1 G T 9: 73,013,327 R741S probably benign Het
Cenpc1 A G 5: 86,013,507 F855L probably damaging Het
Cenpc1 A T 5: 86,032,418 M665K probably benign Het
Cp A G 3: 19,983,477 H832R probably damaging Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dlc1 A C 8: 36,579,253 L730R probably damaging Het
Dmbt1 A T 7: 131,066,621 I536F unknown Het
Dscam G A 16: 96,678,401 T1182I probably benign Het
Eea1 A T 10: 96,018,138 I553F probably damaging Het
Far1 T C 7: 113,561,447 V400A probably benign Het
Fbrsl1 A T 5: 110,433,014 S126T probably benign Het
Frmpd2 A T 14: 33,522,881 E552V possibly damaging Het
Gm5431 T A 11: 48,888,410 T562S probably benign Het
Gm5475 T C 15: 100,427,009 F106S unknown Het
Gpr12 T C 5: 146,583,378 T245A probably damaging Het
Gsta2 A G 9: 78,332,137 Y166H probably benign Het
H6pd A G 4: 149,982,912 V347A probably benign Het
Ifih1 T C 2: 62,645,633 T100A probably benign Het
Itga2 C T 13: 114,886,689 W59* probably null Het
Knstrn T A 2: 118,831,388 probably null Het
Kprp A G 3: 92,823,871 V624A probably damaging Het
Lmbrd2 A G 15: 9,194,684 Y591C probably damaging Het
Map7d1 A G 4: 126,232,873 V842A unknown Het
Mboat2 A T 12: 24,831,709 T4S probably benign Het
Mcph1 T A 8: 18,607,272 probably null Het
Mkl2 A T 16: 13,401,034 M515L possibly damaging Het
Muc5b A G 7: 141,857,535 D1406G unknown Het
Mylk G A 16: 34,785,011 G3D probably damaging Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nemp1 G T 10: 127,695,476 R361L probably damaging Het
Nol4 A C 18: 23,039,789 V85G probably benign Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Obscn T C 11: 59,043,012 E5342G probably damaging Het
Olfr1180 C T 2: 88,412,495 M54I possibly damaging Het
Olfr129 C A 17: 38,055,551 C5F probably damaging Het
Olfr1317 T A 2: 112,142,560 F205Y probably damaging Het
Olfr557 T G 7: 102,699,045 L269R probably damaging Het
Olfr77 A G 9: 19,920,335 N42S possibly damaging Het
Pde4dip A G 3: 97,766,959 S214P probably damaging Het
Per3 A T 4: 151,031,936 C278* probably null Het
Pi4k2a T C 19: 42,090,686 L62P probably damaging Het
Plekha7 C A 7: 116,181,212 G126W probably damaging Het
Ppp1r13b T C 12: 111,834,919 K567E probably damaging Het
Pradc1 T A 6: 85,447,566 Q134L probably benign Het
Pwp2 A G 10: 78,176,336 F628L probably benign Het
Rab5c C T 11: 100,716,102 G217D probably benign Het
Rad51ap2 G T 12: 11,456,806 S243I possibly damaging Het
Rasgrp4 C A 7: 29,148,430 R432S probably damaging Het
Rhot2 C T 17: 25,842,428 probably null Het
Skint6 A T 4: 112,854,489 probably null Het
Slc22a28 T A 19: 8,117,127 T177S probably benign Het
Slc25a24 G T 3: 109,158,644 Q272H probably null Het
Slc3a1 A T 17: 85,032,445 I144F probably damaging Het
Smg9 C T 7: 24,406,070 R176C possibly damaging Het
Sorl1 A T 9: 42,037,203 L762Q probably damaging Het
Srebf2 C A 15: 82,204,069 P1079T probably benign Het
Sub1 A T 15: 11,993,851 S4T probably benign Het
Tacr1 A T 6: 82,492,711 Y192F probably benign Het
Tm4sf19 A T 16: 32,405,996 H54L probably damaging Het
Tnxb T C 17: 34,695,454 L1838P probably damaging Het
Trmt1l T C 1: 151,457,788 S681P possibly damaging Het
Ttc30b A G 2: 75,937,494 F305S probably damaging Het
Ttn A G 2: 76,907,832 V4167A unknown Het
Unc13d T A 11: 116,068,230 M702L probably benign Het
Vgll3 A G 16: 65,839,518 H240R probably benign Het
Vmn1r189 C G 13: 22,102,567 W33C probably benign Het
Vmn2r17 G A 5: 109,428,471 A403T possibly damaging Het
Vmn2r2 G A 3: 64,126,577 T508I probably benign Het
Vps54 T A 11: 21,277,670 probably null Het
Wfs1 G A 5: 36,967,790 Q586* probably null Het
Zbp1 A T 2: 173,213,872 H166Q unknown Het
Zcchc3 G A 2: 152,414,374 A135V probably benign Het
Zfp51 T C 17: 21,463,698 Y192H probably benign Het
Zkscan2 T C 7: 123,489,771 T426A probably benign Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65764440 missense probably benign
IGL00159:Scn2a APN 2 65743090 missense probably damaging 1.00
IGL00418:Scn2a APN 2 65764522 missense probably benign 0.43
IGL00753:Scn2a APN 2 65683863 missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00774:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00847:Scn2a APN 2 65670734 missense probably damaging 1.00
IGL01155:Scn2a APN 2 65717748 missense probably damaging 1.00
IGL01329:Scn2a APN 2 65717508 missense probably benign 0.05
IGL01537:Scn2a APN 2 65715875 missense probably benign 0.00
IGL01672:Scn2a APN 2 65751934 missense probably damaging 1.00
IGL01958:Scn2a APN 2 65701829 missense probably damaging 1.00
IGL02028:Scn2a APN 2 65763658 missense probably damaging 0.96
IGL02142:Scn2a APN 2 65715838 missense probably damaging 1.00
IGL02160:Scn2a APN 2 65730116 missense probably damaging 1.00
IGL02183:Scn2a APN 2 65671603 missense probably benign 0.20
IGL02341:Scn2a APN 2 65688377 missense probably damaging 1.00
IGL02504:Scn2a APN 2 65683884 missense probably benign 0.02
IGL02530:Scn2a APN 2 65730178 missense probably damaging 0.99
IGL02621:Scn2a APN 2 65748879 splice site probably benign
IGL02652:Scn2a APN 2 65702038 missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65701844 missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65671653 missense probably damaging 0.99
IGL03329:Scn2a APN 2 65764629 missense probably benign
IGL03336:Scn2a APN 2 65688744 missense probably damaging 1.00
IGL03391:Scn2a APN 2 65764213 missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65715730 missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65683838 missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65711908 missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65688419 missense probably damaging 1.00
R0021:Scn2a UTSW 2 65670515 missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65711816 missense probably benign 0.01
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0335:Scn2a UTSW 2 65682091 missense probably damaging 1.00
R0508:Scn2a UTSW 2 65717842 missense probably damaging 0.99
R0558:Scn2a UTSW 2 65711925 missense probably benign 0.26
R0600:Scn2a UTSW 2 65701833 missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65751996 missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65686779 splice site probably benign
R1244:Scn2a UTSW 2 65763655 missense probably damaging 0.98
R1386:Scn2a UTSW 2 65688741 missense probably damaging 1.00
R1434:Scn2a UTSW 2 65701991 missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65764594 missense probably benign
R1448:Scn2a UTSW 2 65683845 missense probably benign 0.17
R1460:Scn2a UTSW 2 65701843 missense probably damaging 0.96
R1553:Scn2a UTSW 2 65713836 nonsense probably null
R1642:Scn2a UTSW 2 65683697 missense probably damaging 1.00
R1803:Scn2a UTSW 2 65670767 splice site probably null
R1981:Scn2a UTSW 2 65690170 missense probably damaging 1.00
R2002:Scn2a UTSW 2 65682083 missense probably null 1.00
R2068:Scn2a UTSW 2 65752073 missense probably benign 0.14
R2125:Scn2a UTSW 2 65752079 nonsense probably null
R2126:Scn2a UTSW 2 65752079 nonsense probably null
R2876:Scn2a UTSW 2 65715897 missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65688371 missense probably damaging 1.00
R3113:Scn2a UTSW 2 65748785 missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3750:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3765:Scn2a UTSW 2 65682710 missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65682031 missense probably benign 0.14
R4585:Scn2a UTSW 2 65743051 splice site probably null
R4586:Scn2a UTSW 2 65743051 splice site probably null
R4588:Scn2a UTSW 2 65713767 missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65752027 missense probably benign 0.04
R5108:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R5161:Scn2a UTSW 2 65764591 missense probably benign 0.00
R5235:Scn2a UTSW 2 65752011 missense probably damaging 1.00
R5464:Scn2a UTSW 2 65701756 missense probably damaging 1.00
R5586:Scn2a UTSW 2 65707295 nonsense probably null
R5630:Scn2a UTSW 2 65726365 missense probably damaging 1.00
R5715:Scn2a UTSW 2 65717584 missense probably benign 0.27
R5730:Scn2a UTSW 2 65682538 nonsense probably null
R5734:Scn2a UTSW 2 65717722 missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65764483 missense probably benign 0.00
R6133:Scn2a UTSW 2 65743104 missense probably benign 0.35
R6547:Scn2a UTSW 2 65715897 missense probably benign 0.29
R6549:Scn2a UTSW 2 65764674 missense probably benign 0.05
R6818:Scn2a UTSW 2 65688669 nonsense probably null
R6999:Scn2a UTSW 2 65682109 missense probably benign
R7069:Scn2a UTSW 2 65764606 missense probably benign 0.00
R7073:Scn2a UTSW 2 65728443 missense probably benign 0.00
R7125:Scn2a UTSW 2 65763933 missense probably damaging 1.00
R7178:Scn2a UTSW 2 65748853 nonsense probably null
R7179:Scn2a UTSW 2 65701979 missense probably damaging 1.00
R7203:Scn2a UTSW 2 65748319 missense probably benign 0.01
R7227:Scn2a UTSW 2 65752023 missense probably damaging 0.98
R7358:Scn2a UTSW 2 65682506 nonsense probably null
R7388:Scn2a UTSW 2 65688654 missense probably damaging 1.00
R7491:Scn2a UTSW 2 65702008 missense probably damaging 0.99
R7619:Scn2a UTSW 2 65715903 missense probably damaging 1.00
R7695:Scn2a UTSW 2 65711907 missense probably damaging 0.99
R7735:Scn2a UTSW 2 65763669 missense probably benign 0.40
R7911:Scn2a UTSW 2 65682083 missense probably null 1.00
R7992:Scn2a UTSW 2 65682083 missense probably null 1.00
R8096:Scn2a UTSW 2 65764022 missense probably damaging 0.98
Z1176:Scn2a UTSW 2 65751868 missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65717735 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCAGTCAGTAACATTATTGGC -3'
(R):5'- GGAGGTCCACTATTTAGTATAGGG -3'

Sequencing Primer
(F):5'- GCAGTCAGTAACATTATTGGCTATTG -3'
(R):5'- CACTATTTAGTATAGGGGCCAGC -3'
Posted On2019-06-26