Incidental Mutation 'R7269:Zbp1'
ID565123
Institutional Source Beutler Lab
Gene Symbol Zbp1
Ensembl Gene ENSMUSG00000027514
Gene NameZ-DNA binding protein 1
SynonymsDai, mZaDLM
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7269 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location173206612-173218923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173213872 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 166 (H166Q)
Ref Sequence ENSEMBL: ENSMUSP00000104744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029018] [ENSMUST00000109116]
Predicted Effect probably benign
Transcript: ENSMUST00000029018
SMART Domains Protein: ENSMUSP00000029018
Gene: ENSMUSG00000027514

DomainStartEndE-ValueType
Zalpha 6 72 5.32e-23 SMART
Zalpha 82 147 7.64e-24 SMART
Pfam:RHIM 163 202 1.8e-8 PFAM
Pfam:RHIM 208 258 1.2e-5 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000109116
AA Change: H166Q
SMART Domains Protein: ENSMUSP00000104744
Gene: ENSMUSG00000027514
AA Change: H166Q

DomainStartEndE-ValueType
Zalpha 6 72 5.32e-23 SMART
Zalpha 82 147 7.64e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display normal innate immune activation by double-stranded B-form DNA (B-DNA) as well as normal adaptive immune responses to DNA vaccination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A T 18: 24,472,956 N36I probably damaging Het
A430033K04Rik T A 5: 138,646,752 Y300N possibly damaging Het
Adipor2 T C 6: 119,370,244 Q26R probably benign Het
Ahnak T A 19: 9,006,617 M1755K probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
AI837181 C A 19: 5,426,434 S208R probably damaging Het
Akap2 G T 4: 57,855,217 R182L probably damaging Het
Arhgap35 T G 7: 16,561,727 M1138L probably benign Het
Card14 T G 11: 119,337,747 L633R probably damaging Het
Carmil3 A G 14: 55,493,895 T144A probably benign Het
Cbfa2t2 T A 2: 154,515,975 N223K probably benign Het
Ccdc39 T C 3: 33,830,105 I363V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccpg1 G T 9: 73,013,327 R741S probably benign Het
Cenpc1 A G 5: 86,013,507 F855L probably damaging Het
Cenpc1 A T 5: 86,032,418 M665K probably benign Het
Cp A G 3: 19,983,477 H832R probably damaging Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dlc1 A C 8: 36,579,253 L730R probably damaging Het
Dmbt1 A T 7: 131,066,621 I536F unknown Het
Dscam G A 16: 96,678,401 T1182I probably benign Het
Eea1 A T 10: 96,018,138 I553F probably damaging Het
Far1 T C 7: 113,561,447 V400A probably benign Het
Fbrsl1 A T 5: 110,433,014 S126T probably benign Het
Frmpd2 A T 14: 33,522,881 E552V possibly damaging Het
Gm5431 T A 11: 48,888,410 T562S probably benign Het
Gm5475 T C 15: 100,427,009 F106S unknown Het
Gpr12 T C 5: 146,583,378 T245A probably damaging Het
Gsta2 A G 9: 78,332,137 Y166H probably benign Het
H6pd A G 4: 149,982,912 V347A probably benign Het
Ifih1 T C 2: 62,645,633 T100A probably benign Het
Itga2 C T 13: 114,886,689 W59* probably null Het
Knstrn T A 2: 118,831,388 probably null Het
Kprp A G 3: 92,823,871 V624A probably damaging Het
Lmbrd2 A G 15: 9,194,684 Y591C probably damaging Het
Map7d1 A G 4: 126,232,873 V842A unknown Het
Mboat2 A T 12: 24,831,709 T4S probably benign Het
Mcph1 T A 8: 18,607,272 probably null Het
Mkl2 A T 16: 13,401,034 M515L possibly damaging Het
Muc5b A G 7: 141,857,535 D1406G unknown Het
Mylk G A 16: 34,785,011 G3D probably damaging Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nemp1 G T 10: 127,695,476 R361L probably damaging Het
Nol4 A C 18: 23,039,789 V85G probably benign Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Obscn T C 11: 59,043,012 E5342G probably damaging Het
Olfr1180 C T 2: 88,412,495 M54I possibly damaging Het
Olfr129 C A 17: 38,055,551 C5F probably damaging Het
Olfr1317 T A 2: 112,142,560 F205Y probably damaging Het
Olfr557 T G 7: 102,699,045 L269R probably damaging Het
Olfr77 A G 9: 19,920,335 N42S possibly damaging Het
Pde4dip A G 3: 97,766,959 S214P probably damaging Het
Per3 A T 4: 151,031,936 C278* probably null Het
Pi4k2a T C 19: 42,090,686 L62P probably damaging Het
Plekha7 C A 7: 116,181,212 G126W probably damaging Het
Ppp1r13b T C 12: 111,834,919 K567E probably damaging Het
Pradc1 T A 6: 85,447,566 Q134L probably benign Het
Pwp2 A G 10: 78,176,336 F628L probably benign Het
Rab5c C T 11: 100,716,102 G217D probably benign Het
Rad51ap2 G T 12: 11,456,806 S243I possibly damaging Het
Rasgrp4 C A 7: 29,148,430 R432S probably damaging Het
Rhot2 C T 17: 25,842,428 probably null Het
Scn2a T A 2: 65,763,769 L1654Q probably damaging Het
Skint6 A T 4: 112,854,489 probably null Het
Slc22a28 T A 19: 8,117,127 T177S probably benign Het
Slc25a24 G T 3: 109,158,644 Q272H probably null Het
Slc3a1 A T 17: 85,032,445 I144F probably damaging Het
Smg9 C T 7: 24,406,070 R176C possibly damaging Het
Sorl1 A T 9: 42,037,203 L762Q probably damaging Het
Srebf2 C A 15: 82,204,069 P1079T probably benign Het
Sub1 A T 15: 11,993,851 S4T probably benign Het
Tacr1 A T 6: 82,492,711 Y192F probably benign Het
Tm4sf19 A T 16: 32,405,996 H54L probably damaging Het
Tnxb T C 17: 34,695,454 L1838P probably damaging Het
Trmt1l T C 1: 151,457,788 S681P possibly damaging Het
Ttc30b A G 2: 75,937,494 F305S probably damaging Het
Ttn A G 2: 76,907,832 V4167A unknown Het
Unc13d T A 11: 116,068,230 M702L probably benign Het
Vgll3 A G 16: 65,839,518 H240R probably benign Het
Vmn1r189 C G 13: 22,102,567 W33C probably benign Het
Vmn2r17 G A 5: 109,428,471 A403T possibly damaging Het
Vmn2r2 G A 3: 64,126,577 T508I probably benign Het
Vps54 T A 11: 21,277,670 probably null Het
Wfs1 G A 5: 36,967,790 Q586* probably null Het
Zcchc3 G A 2: 152,414,374 A135V probably benign Het
Zfp51 T C 17: 21,463,698 Y192H probably benign Het
Zkscan2 T C 7: 123,489,771 T426A probably benign Het
Other mutations in Zbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Zbp1 APN 2 173212245 missense possibly damaging 0.95
IGL01924:Zbp1 APN 2 173212254 missense probably benign 0.09
IGL02804:Zbp1 APN 2 173209146 missense probably damaging 1.00
PIT4362001:Zbp1 UTSW 2 173216990 missense probably damaging 1.00
R2100:Zbp1 UTSW 2 173209244 missense probably damaging 1.00
R2269:Zbp1 UTSW 2 173218823 start gained probably benign
R3795:Zbp1 UTSW 2 173212179 missense probably benign 0.21
R4649:Zbp1 UTSW 2 173207815 missense possibly damaging 0.56
R4653:Zbp1 UTSW 2 173207815 missense possibly damaging 0.56
R4792:Zbp1 UTSW 2 173209213 missense probably damaging 1.00
R4807:Zbp1 UTSW 2 173212206 missense probably damaging 1.00
R5899:Zbp1 UTSW 2 173210547 missense probably benign 0.29
R6290:Zbp1 UTSW 2 173215841 missense probably damaging 1.00
R6705:Zbp1 UTSW 2 173213887 nonsense probably null
R6835:Zbp1 UTSW 2 173213911 critical splice acceptor site probably null
R7337:Zbp1 UTSW 2 173218753 nonsense probably null
R7419:Zbp1 UTSW 2 173209165 missense probably benign 0.00
R7429:Zbp1 UTSW 2 173213818 missense unknown
R7508:Zbp1 UTSW 2 173207811 missense possibly damaging 0.72
R8021:Zbp1 UTSW 2 173209210 missense possibly damaging 0.78
Z1177:Zbp1 UTSW 2 173207741 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTAACAATGAGCATACTTGGGATG -3'
(R):5'- TAGTCACTTGAAGAAGGCAGGC -3'

Sequencing Primer
(F):5'- GCATACTTGGGATGAAACAGTTTAG -3'
(R):5'- CTGGGCTAGACTTGTATAGAAGCC -3'
Posted On2019-06-26