Incidental Mutation 'R7269:Dmbt1'
ID565153
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Namedeleted in malignant brain tumors 1
SynonymsCRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R7269 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location131032053-131121630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131066621 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 536 (I536F)
Ref Sequence ENSEMBL: ENSMUSP00000146685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
Predicted Effect unknown
Transcript: ENSMUST00000084509
AA Change: I525F
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: I525F

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: I536F
Predicted Effect probably benign
Transcript: ENSMUST00000213064
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A T 18: 24,472,956 N36I probably damaging Het
A430033K04Rik T A 5: 138,646,752 Y300N possibly damaging Het
Adipor2 T C 6: 119,370,244 Q26R probably benign Het
Ahnak T A 19: 9,006,617 M1755K probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
AI837181 C A 19: 5,426,434 S208R probably damaging Het
Akap2 G T 4: 57,855,217 R182L probably damaging Het
Arhgap35 T G 7: 16,561,727 M1138L probably benign Het
Card14 T G 11: 119,337,747 L633R probably damaging Het
Carmil3 A G 14: 55,493,895 T144A probably benign Het
Cbfa2t2 T A 2: 154,515,975 N223K probably benign Het
Ccdc39 T C 3: 33,830,105 I363V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccpg1 G T 9: 73,013,327 R741S probably benign Het
Cenpc1 A G 5: 86,013,507 F855L probably damaging Het
Cenpc1 A T 5: 86,032,418 M665K probably benign Het
Cp A G 3: 19,983,477 H832R probably damaging Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dlc1 A C 8: 36,579,253 L730R probably damaging Het
Dscam G A 16: 96,678,401 T1182I probably benign Het
Eea1 A T 10: 96,018,138 I553F probably damaging Het
Far1 T C 7: 113,561,447 V400A probably benign Het
Fbrsl1 A T 5: 110,433,014 S126T probably benign Het
Frmpd2 A T 14: 33,522,881 E552V possibly damaging Het
Gm5431 T A 11: 48,888,410 T562S probably benign Het
Gm5475 T C 15: 100,427,009 F106S unknown Het
Gpr12 T C 5: 146,583,378 T245A probably damaging Het
Gsta2 A G 9: 78,332,137 Y166H probably benign Het
H6pd A G 4: 149,982,912 V347A probably benign Het
Ifih1 T C 2: 62,645,633 T100A probably benign Het
Itga2 C T 13: 114,886,689 W59* probably null Het
Knstrn T A 2: 118,831,388 probably null Het
Kprp A G 3: 92,823,871 V624A probably damaging Het
Lmbrd2 A G 15: 9,194,684 Y591C probably damaging Het
Map7d1 A G 4: 126,232,873 V842A unknown Het
Mboat2 A T 12: 24,831,709 T4S probably benign Het
Mcph1 T A 8: 18,607,272 probably null Het
Mkl2 A T 16: 13,401,034 M515L possibly damaging Het
Muc5b A G 7: 141,857,535 D1406G unknown Het
Mylk G A 16: 34,785,011 G3D probably damaging Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nemp1 G T 10: 127,695,476 R361L probably damaging Het
Nol4 A C 18: 23,039,789 V85G probably benign Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Obscn T C 11: 59,043,012 E5342G probably damaging Het
Olfr1180 C T 2: 88,412,495 M54I possibly damaging Het
Olfr129 C A 17: 38,055,551 C5F probably damaging Het
Olfr1317 T A 2: 112,142,560 F205Y probably damaging Het
Olfr557 T G 7: 102,699,045 L269R probably damaging Het
Olfr77 A G 9: 19,920,335 N42S possibly damaging Het
Pde4dip A G 3: 97,766,959 S214P probably damaging Het
Per3 A T 4: 151,031,936 C278* probably null Het
Pi4k2a T C 19: 42,090,686 L62P probably damaging Het
Plekha7 C A 7: 116,181,212 G126W probably damaging Het
Ppp1r13b T C 12: 111,834,919 K567E probably damaging Het
Pradc1 T A 6: 85,447,566 Q134L probably benign Het
Pwp2 A G 10: 78,176,336 F628L probably benign Het
Rab5c C T 11: 100,716,102 G217D probably benign Het
Rad51ap2 G T 12: 11,456,806 S243I possibly damaging Het
Rasgrp4 C A 7: 29,148,430 R432S probably damaging Het
Rhot2 C T 17: 25,842,428 probably null Het
Scn2a T A 2: 65,763,769 L1654Q probably damaging Het
Skint6 A T 4: 112,854,489 probably null Het
Slc22a28 T A 19: 8,117,127 T177S probably benign Het
Slc25a24 G T 3: 109,158,644 Q272H probably null Het
Slc3a1 A T 17: 85,032,445 I144F probably damaging Het
Smg9 C T 7: 24,406,070 R176C possibly damaging Het
Sorl1 A T 9: 42,037,203 L762Q probably damaging Het
Srebf2 C A 15: 82,204,069 P1079T probably benign Het
Sub1 A T 15: 11,993,851 S4T probably benign Het
Tacr1 A T 6: 82,492,711 Y192F probably benign Het
Tm4sf19 A T 16: 32,405,996 H54L probably damaging Het
Tnxb T C 17: 34,695,454 L1838P probably damaging Het
Trmt1l T C 1: 151,457,788 S681P possibly damaging Het
Ttc30b A G 2: 75,937,494 F305S probably damaging Het
Ttn A G 2: 76,907,832 V4167A unknown Het
Unc13d T A 11: 116,068,230 M702L probably benign Het
Vgll3 A G 16: 65,839,518 H240R probably benign Het
Vmn1r189 C G 13: 22,102,567 W33C probably benign Het
Vmn2r17 G A 5: 109,428,471 A403T possibly damaging Het
Vmn2r2 G A 3: 64,126,577 T508I probably benign Het
Vps54 T A 11: 21,277,670 probably null Het
Wfs1 G A 5: 36,967,790 Q586* probably null Het
Zbp1 A T 2: 173,213,872 H166Q unknown Het
Zcchc3 G A 2: 152,414,374 A135V probably benign Het
Zfp51 T C 17: 21,463,698 Y192H probably benign Het
Zkscan2 T C 7: 123,489,771 T426A probably benign Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131079540 intron probably benign
IGL00161:Dmbt1 APN 7 131109628 missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131099290 missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131082500 missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131097607 missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131058158 missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131085368 splice site probably benign
IGL01317:Dmbt1 APN 7 131041191 missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131088767 missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131103679 missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131116728 missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131081185 missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131074419 intron probably benign
IGL02160:Dmbt1 APN 7 131082688 missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131093256 splice site probably benign
IGL02197:Dmbt1 APN 7 131085422 splice site probably benign
IGL02332:Dmbt1 APN 7 131066613 intron probably benign
IGL02427:Dmbt1 APN 7 131088085 splice site probably null
IGL02726:Dmbt1 APN 7 131074410 intron probably benign
IGL02967:Dmbt1 APN 7 131071189 missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131082679 missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131111049 missense probably damaging 0.99
H8562:Dmbt1 UTSW 7 131112076 nonsense probably null
K3955:Dmbt1 UTSW 7 131119564 missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131106393 missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131096049 splice site probably benign
R0427:Dmbt1 UTSW 7 131040902 nonsense probably null
R0478:Dmbt1 UTSW 7 131041187 missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131097673 splice site probably null
R0538:Dmbt1 UTSW 7 131049901 splice site probably benign
R0626:Dmbt1 UTSW 7 131102081 missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131097653 missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131093117 missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131074524 critical splice donor site probably null
R1413:Dmbt1 UTSW 7 131050214 missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 131044487 splice site probably benign
R1463:Dmbt1 UTSW 7 131109637 critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131074331 intron probably benign
R1990:Dmbt1 UTSW 7 131058288 missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131106359 missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 131099133 missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 131050018 missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 131102032 missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131097575 missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131046562 missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131090494 missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131106468 missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131094734 nonsense probably null
R3014:Dmbt1 UTSW 7 131032097 intron probably benign
R3155:Dmbt1 UTSW 7 131050157 nonsense probably null
R3176:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131106249 missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131112090 missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131074202 intron probably benign
R4396:Dmbt1 UTSW 7 131116632 missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131040934 missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 131050012 missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131094742 missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131097670 critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131094735 missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131082619 missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 131041021 missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131119511 missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131040993 missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131063403 intron probably benign
R5526:Dmbt1 UTSW 7 131041190 missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131099300 nonsense probably null
R5566:Dmbt1 UTSW 7 131106273 missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131054067 missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131109641 splice site probably null
R6188:Dmbt1 UTSW 7 131097631 missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131058254 missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131103578 missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131116641 missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131046510 intron probably null
R6719:Dmbt1 UTSW 7 131119603 missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131046561 missense probably benign 0.16
R7148:Dmbt1 UTSW 7 131066734 nonsense probably null
R7191:Dmbt1 UTSW 7 131044520 missense unknown
R7288:Dmbt1 UTSW 7 131083789 nonsense probably null
R7296:Dmbt1 UTSW 7 131112132 missense unknown
R7349:Dmbt1 UTSW 7 131041124 missense unknown
R7386:Dmbt1 UTSW 7 131112236 missense unknown
R7428:Dmbt1 UTSW 7 131108463 missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 131079511 critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 131066462 missense unknown
R7513:Dmbt1 UTSW 7 131090512 missense unknown
R7553:Dmbt1 UTSW 7 131104867 missense unknown
R7567:Dmbt1 UTSW 7 131061363 splice site probably null
R7584:Dmbt1 UTSW 7 131088751 nonsense probably null
R7736:Dmbt1 UTSW 7 131116896 missense unknown
R7758:Dmbt1 UTSW 7 131121197 missense unknown
R8080:Dmbt1 UTSW 7 131088770 missense unknown
R8098:Dmbt1 UTSW 7 131108459 nonsense probably null
R8125:Dmbt1 UTSW 7 131099223 missense unknown
X0024:Dmbt1 UTSW 7 131112248 nonsense probably null
X0062:Dmbt1 UTSW 7 131094851 missense possibly damaging 0.81
Z1176:Dmbt1 UTSW 7 131088812 missense unknown
Z1177:Dmbt1 UTSW 7 131082485 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGAGAAACCACCATGTCTTTCC -3'
(R):5'- GTGACCTGAGCTCATTGCAG -3'

Sequencing Primer
(F):5'- CATGTCTTTCCAGGAACAGATTCTGG -3'
(R):5'- TGAGCTCATTGCAGCCAAG -3'
Posted On2019-06-26