Incidental Mutation 'R7269:Mylk'
ID565184
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Namemyosin, light polypeptide kinase
SynonymsMlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7269 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location34745210-35002420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34785011 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 3 (G3D)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
Predicted Effect probably damaging
Transcript: ENSMUST00000023538
AA Change: G3D

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: G3D

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A T 18: 24,472,956 N36I probably damaging Het
A430033K04Rik T A 5: 138,646,752 Y300N possibly damaging Het
Adipor2 T C 6: 119,370,244 Q26R probably benign Het
Ahnak T A 19: 9,006,617 M1755K probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
AI837181 C A 19: 5,426,434 S208R probably damaging Het
Akap2 G T 4: 57,855,217 R182L probably damaging Het
Arhgap35 T G 7: 16,561,727 M1138L probably benign Het
Card14 T G 11: 119,337,747 L633R probably damaging Het
Carmil3 A G 14: 55,493,895 T144A probably benign Het
Cbfa2t2 T A 2: 154,515,975 N223K probably benign Het
Ccdc39 T C 3: 33,830,105 I363V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccpg1 G T 9: 73,013,327 R741S probably benign Het
Cenpc1 A G 5: 86,013,507 F855L probably damaging Het
Cenpc1 A T 5: 86,032,418 M665K probably benign Het
Cp A G 3: 19,983,477 H832R probably damaging Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dlc1 A C 8: 36,579,253 L730R probably damaging Het
Dmbt1 A T 7: 131,066,621 I536F unknown Het
Dscam G A 16: 96,678,401 T1182I probably benign Het
Eea1 A T 10: 96,018,138 I553F probably damaging Het
Far1 T C 7: 113,561,447 V400A probably benign Het
Fbrsl1 A T 5: 110,433,014 S126T probably benign Het
Frmpd2 A T 14: 33,522,881 E552V possibly damaging Het
Gm5431 T A 11: 48,888,410 T562S probably benign Het
Gm5475 T C 15: 100,427,009 F106S unknown Het
Gpr12 T C 5: 146,583,378 T245A probably damaging Het
Gsta2 A G 9: 78,332,137 Y166H probably benign Het
H6pd A G 4: 149,982,912 V347A probably benign Het
Ifih1 T C 2: 62,645,633 T100A probably benign Het
Itga2 C T 13: 114,886,689 W59* probably null Het
Knstrn T A 2: 118,831,388 probably null Het
Kprp A G 3: 92,823,871 V624A probably damaging Het
Lmbrd2 A G 15: 9,194,684 Y591C probably damaging Het
Map7d1 A G 4: 126,232,873 V842A unknown Het
Mboat2 A T 12: 24,831,709 T4S probably benign Het
Mcph1 T A 8: 18,607,272 probably null Het
Mkl2 A T 16: 13,401,034 M515L possibly damaging Het
Muc5b A G 7: 141,857,535 D1406G unknown Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nemp1 G T 10: 127,695,476 R361L probably damaging Het
Nol4 A C 18: 23,039,789 V85G probably benign Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Obscn T C 11: 59,043,012 E5342G probably damaging Het
Olfr1180 C T 2: 88,412,495 M54I possibly damaging Het
Olfr129 C A 17: 38,055,551 C5F probably damaging Het
Olfr1317 T A 2: 112,142,560 F205Y probably damaging Het
Olfr557 T G 7: 102,699,045 L269R probably damaging Het
Olfr77 A G 9: 19,920,335 N42S possibly damaging Het
Pde4dip A G 3: 97,766,959 S214P probably damaging Het
Per3 A T 4: 151,031,936 C278* probably null Het
Pi4k2a T C 19: 42,090,686 L62P probably damaging Het
Plekha7 C A 7: 116,181,212 G126W probably damaging Het
Ppp1r13b T C 12: 111,834,919 K567E probably damaging Het
Pradc1 T A 6: 85,447,566 Q134L probably benign Het
Pwp2 A G 10: 78,176,336 F628L probably benign Het
Rab5c C T 11: 100,716,102 G217D probably benign Het
Rad51ap2 G T 12: 11,456,806 S243I possibly damaging Het
Rasgrp4 C A 7: 29,148,430 R432S probably damaging Het
Rhot2 C T 17: 25,842,428 probably null Het
Scn2a T A 2: 65,763,769 L1654Q probably damaging Het
Skint6 A T 4: 112,854,489 probably null Het
Slc22a28 T A 19: 8,117,127 T177S probably benign Het
Slc25a24 G T 3: 109,158,644 Q272H probably null Het
Slc3a1 A T 17: 85,032,445 I144F probably damaging Het
Smg9 C T 7: 24,406,070 R176C possibly damaging Het
Sorl1 A T 9: 42,037,203 L762Q probably damaging Het
Srebf2 C A 15: 82,204,069 P1079T probably benign Het
Sub1 A T 15: 11,993,851 S4T probably benign Het
Tacr1 A T 6: 82,492,711 Y192F probably benign Het
Tm4sf19 A T 16: 32,405,996 H54L probably damaging Het
Tnxb T C 17: 34,695,454 L1838P probably damaging Het
Trmt1l T C 1: 151,457,788 S681P possibly damaging Het
Ttc30b A G 2: 75,937,494 F305S probably damaging Het
Ttn A G 2: 76,907,832 V4167A unknown Het
Unc13d T A 11: 116,068,230 M702L probably benign Het
Vgll3 A G 16: 65,839,518 H240R probably benign Het
Vmn1r189 C G 13: 22,102,567 W33C probably benign Het
Vmn2r17 G A 5: 109,428,471 A403T possibly damaging Het
Vmn2r2 G A 3: 64,126,577 T508I probably benign Het
Vps54 T A 11: 21,277,670 probably null Het
Wfs1 G A 5: 36,967,790 Q586* probably null Het
Zbp1 A T 2: 173,213,872 H166Q unknown Het
Zcchc3 G A 2: 152,414,374 A135V probably benign Het
Zfp51 T C 17: 21,463,698 Y192H probably benign Het
Zkscan2 T C 7: 123,489,771 T426A probably benign Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
brutus UTSW 16 34953695 missense probably benign 0.12
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 utr 5 prime probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACATTCCCTGGTACGTGC -3'
(R):5'- GGACTCATGCATGAATAATCTCTAGC -3'

Sequencing Primer
(F):5'- AAGCAGTTCTCCAGGCCC -3'
(R):5'- GCATGAATAATCTCTAGCAGAAGC -3'
Posted On2019-06-26