Incidental Mutation 'R7270:Slc25a12'
ID565207
Institutional Source Beutler Lab
Gene Symbol Slc25a12
Ensembl Gene ENSMUSG00000027010
Gene Namesolute carrier family 25 (mitochondrial carrier, Aralar), member 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R7270 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location71271063-71367749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71324025 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 139 (H139R)
Ref Sequence ENSEMBL: ENSMUSP00000122103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151937] [ENSMUST00000184169]
Predicted Effect probably benign
Transcript: ENSMUST00000151937
AA Change: H139R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122103
Gene: ENSMUSG00000027010
AA Change: H139R

DomainStartEndE-ValueType
EFh 56 84 1.83e1 SMART
EFh 90 118 5.8e-1 SMART
EFh 161 189 2.49e0 SMART
Pfam:Mito_carr 324 421 3e-27 PFAM
Pfam:Mito_carr 422 513 2.9e-18 PFAM
Pfam:Mito_carr 515 609 2.1e-27 PFAM
low complexity region 662 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184169
SMART Domains Protein: ENSMUSP00000139371
Gene: ENSMUSG00000027010

DomainStartEndE-ValueType
SCOP:d1irja_ 3 71 5e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding mitochondrial carrier protein. The encoded protein localizes to the mitochondria and is involved in the exchange of aspartate for glutamate across the inner mitochondrial membrane. Polymorphisms in this gene may be associated with autism, and mutations in this gene may also be a cause of global cerebral hypomyelination. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a null allele show severe growth defects, generalized tremors, postnatal lethality, impaired motor coordination, and CNS dysmyelination associated with decreased synthesis of myelin lipids and a striking reduction in brain aspartate and N-acetylaspartate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l A T 10: 42,425,249 Y193N probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
Aimp1 T C 3: 132,677,011 K44E probably damaging Het
Arid1b T A 17: 4,996,043 Y369N unknown Het
Art5 A T 7: 102,097,873 V233D probably damaging Het
Baz2b T A 2: 59,962,492 N431Y possibly damaging Het
Bik T A 15: 83,544,163 F131I possibly damaging Het
Bmpr1a A G 14: 34,441,125 Y103H probably damaging Het
Cabp7 C T 11: 4,746,676 V18M possibly damaging Het
Cacna1a C A 8: 84,571,237 T1240N probably damaging Het
Cacna1h A G 17: 25,384,765 V1311A probably damaging Het
Cbarp A C 10: 80,137,317 S16A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2b A T 8: 104,837,840 H494L possibly damaging Het
Cfap43 T A 19: 47,739,785 H1511L possibly damaging Het
Cfap54 A G 10: 92,839,458 V2867A probably benign Het
Col5a1 C T 2: 27,997,585 P956L unknown Het
Dcakd T G 11: 103,000,206 Q19P possibly damaging Het
Ddx47 T A 6: 135,023,338 D432E probably benign Het
Dhrs7b T C 11: 60,844,229 F29L probably benign Het
Dis3l2 A T 1: 86,990,303 D558V possibly damaging Het
Dtx3l T A 16: 35,933,657 D193V probably damaging Het
Epha4 G A 1: 77,399,785 R486C probably damaging Het
Fam186a T C 15: 99,944,152 T1404A possibly damaging Het
Fat1 A G 8: 45,037,438 T3796A probably damaging Het
Ffar2 A T 7: 30,819,504 W204R probably benign Het
Ftmt A G 18: 52,332,019 I136V probably benign Het
Gm10300 T C 4: 132,074,856 W54R unknown Het
Gm10518 C T 1: 179,803,384 P3L unknown Het
Gm5788 T C 12: 87,494,893 L58P probably damaging Het
Gm9733 A T 3: 15,320,644 I66N probably benign Het
Grm2 G A 9: 106,651,058 T209M probably damaging Het
Gtdc1 C T 2: 44,635,310 M176I probably benign Het
Insrr T C 3: 87,803,133 L382P probably damaging Het
Jade2 A G 11: 51,817,184 V734A possibly damaging Het
Kcnh4 C T 11: 100,747,646 R586H probably benign Het
Kdm1a A T 4: 136,552,527 D721E probably damaging Het
Knl1 G A 2: 119,102,522 C2054Y possibly damaging Het
Lrrk2 C T 15: 91,700,441 P354S probably benign Het
Luzp2 A G 7: 55,075,026 I112V probably damaging Het
Mgl2 T C 11: 70,135,680 S105P probably damaging Het
Mocs1 T A 17: 49,449,115 M200K possibly damaging Het
Oat T A 7: 132,567,198 I98L probably benign Het
Obscn T C 11: 59,029,486 Y8C Het
Olfr1462 G A 19: 13,191,404 V246I possibly damaging Het
Olfr786 T G 10: 129,437,450 F213V probably benign Het
Pde1b T A 15: 103,521,655 M137K possibly damaging Het
Phf21a T C 2: 92,327,139 I204T probably damaging Het
Plcd4 A G 1: 74,554,679 E321G possibly damaging Het
Plpp7 C T 2: 32,095,650 probably benign Het
Prdm1 A G 10: 44,441,570 I419T probably benign Het
Sec16b A T 1: 157,564,462 R855W probably damaging Het
Sec16b G T 1: 157,564,463 R855M probably damaging Het
Sec31b T C 19: 44,523,043 T640A probably benign Het
Siglec1 T C 2: 131,081,551 T425A possibly damaging Het
Skil T C 3: 31,097,175 probably benign Het
Slc1a5 G A 7: 16,785,698 V200M probably damaging Het
Slc25a32 A T 15: 39,098,235 V187D probably damaging Het
Slc35a3 G A 3: 116,711,806 probably benign Het
Smap2 C A 4: 120,972,067 M328I probably benign Het
Spef2 C T 15: 9,599,980 probably null Het
Srarp A G 4: 141,433,078 V148A possibly damaging Het
Stard9 T A 2: 120,634,274 Y73* probably null Het
Tars A G 15: 11,392,019 C236R probably benign Het
Tchh G C 3: 93,444,530 D426H unknown Het
Tnks2 T C 19: 36,859,145 F17S Het
Ube2g1 T C 11: 72,663,113 I30T possibly damaging Het
Ube2o C T 11: 116,543,935 D567N possibly damaging Het
Unc5b A T 10: 60,772,223 Y710* probably null Het
Vmn1r215 T C 13: 23,075,919 V43A possibly damaging Het
Xkr8 A G 4: 132,728,337 F242L probably benign Het
Zfp526 T A 7: 25,225,920 C535S probably damaging Het
Other mutations in Slc25a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Slc25a12 APN 2 71344032 missense possibly damaging 0.63
IGL01116:Slc25a12 APN 2 71293352 splice site probably benign
IGL01375:Slc25a12 APN 2 71308050 splice site probably benign
IGL02631:Slc25a12 APN 2 71296742 missense possibly damaging 0.90
IGL02899:Slc25a12 APN 2 71279635 missense probably damaging 1.00
R0031:Slc25a12 UTSW 2 71333614 missense possibly damaging 0.93
R0689:Slc25a12 UTSW 2 71311493 missense possibly damaging 0.95
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R1832:Slc25a12 UTSW 2 71333710 missense possibly damaging 0.85
R2044:Slc25a12 UTSW 2 71312548 missense probably benign 0.00
R4537:Slc25a12 UTSW 2 71275106 utr 3 prime probably benign
R4668:Slc25a12 UTSW 2 71315062 missense probably benign 0.22
R4830:Slc25a12 UTSW 2 71296805 missense probably damaging 1.00
R5476:Slc25a12 UTSW 2 71275322 missense probably benign
R5698:Slc25a12 UTSW 2 71282573 missense probably damaging 1.00
R6074:Slc25a12 UTSW 2 71276454 missense probably benign 0.01
R6516:Slc25a12 UTSW 2 71324083 missense probably damaging 0.97
R7794:Slc25a12 UTSW 2 71311508 missense probably damaging 1.00
R8022:Slc25a12 UTSW 2 71275189 missense unknown
Z1176:Slc25a12 UTSW 2 71296746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTACTTACATGAATGCACGTACAGG -3'
(R):5'- TAGAAGCAGCCGGTCTTGAC -3'

Sequencing Primer
(F):5'- TGCACGTACAGGCTGAAAG -3'
(R):5'- AGCAGCCGGTCTTGACTTTTTAAAC -3'
Posted On2019-06-26