Incidental Mutation 'R7270:Afg1l'
ID565235
Institutional Source Beutler Lab
Gene Symbol Afg1l
Ensembl Gene ENSMUSG00000038302
Gene NameAFG1 like ATPase
SynonymsLace1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7270 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location42312585-42478565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42425249 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 193 (Y193N)
Ref Sequence ENSEMBL: ENSMUSP00000036149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041024] [ENSMUST00000133326]
Predicted Effect probably damaging
Transcript: ENSMUST00000041024
AA Change: Y193N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036149
Gene: ENSMUSG00000038302
AA Change: Y193N

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 74 432 4.4e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133326
AA Change: Y193N

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123510
Gene: ENSMUSG00000038302
AA Change: Y193N

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 73 272 2e-64 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119620
Gene: ENSMUSG00000038302
AA Change: Y20N

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 2 80 5.3e-29 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000120389
Gene: ENSMUSG00000038302
AA Change: Y60N

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 5 300 2e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial integral membrane protein that plays a role in mitochondrial protein homeostasis. The protein contains a P-loop motif and a five-domain structure that is conserved in fly, yeast, and bacteria. It functions to mediate the degradation of nuclear-encoded complex IV subunits. Two conserved estrogen receptor binding sites are located within 2.5 kb of this gene. Polymorphisms in this gene have been associated with bipolar disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 A T 12: 112,780,802 V70E Het
Aimp1 T C 3: 132,677,011 K44E probably damaging Het
Arid1b T A 17: 4,996,043 Y369N unknown Het
Art5 A T 7: 102,097,873 V233D probably damaging Het
Baz2b T A 2: 59,962,492 N431Y possibly damaging Het
Bik T A 15: 83,544,163 F131I possibly damaging Het
Bmpr1a A G 14: 34,441,125 Y103H probably damaging Het
Cabp7 C T 11: 4,746,676 V18M possibly damaging Het
Cacna1a C A 8: 84,571,237 T1240N probably damaging Het
Cacna1h A G 17: 25,384,765 V1311A probably damaging Het
Cbarp A C 10: 80,137,317 S16A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2b A T 8: 104,837,840 H494L possibly damaging Het
Cfap43 T A 19: 47,739,785 H1511L possibly damaging Het
Cfap54 A G 10: 92,839,458 V2867A probably benign Het
Col5a1 C T 2: 27,997,585 P956L unknown Het
Dcakd T G 11: 103,000,206 Q19P possibly damaging Het
Ddx47 T A 6: 135,023,338 D432E probably benign Het
Dhrs7b T C 11: 60,844,229 F29L probably benign Het
Dis3l2 A T 1: 86,990,303 D558V possibly damaging Het
Dtx3l T A 16: 35,933,657 D193V probably damaging Het
Epha4 G A 1: 77,399,785 R486C probably damaging Het
Fam186a T C 15: 99,944,152 T1404A possibly damaging Het
Fat1 A G 8: 45,037,438 T3796A probably damaging Het
Ffar2 A T 7: 30,819,504 W204R probably benign Het
Ftmt A G 18: 52,332,019 I136V probably benign Het
Gm10300 T C 4: 132,074,856 W54R unknown Het
Gm10518 C T 1: 179,803,384 P3L unknown Het
Gm5788 T C 12: 87,494,893 L58P probably damaging Het
Gm9733 A T 3: 15,320,644 I66N probably benign Het
Grm2 G A 9: 106,651,058 T209M probably damaging Het
Gtdc1 C T 2: 44,635,310 M176I probably benign Het
Insrr T C 3: 87,803,133 L382P probably damaging Het
Jade2 A G 11: 51,817,184 V734A possibly damaging Het
Kcnh4 C T 11: 100,747,646 R586H probably benign Het
Kdm1a A T 4: 136,552,527 D721E probably damaging Het
Knl1 G A 2: 119,102,522 C2054Y possibly damaging Het
Lrrk2 C T 15: 91,700,441 P354S probably benign Het
Luzp2 A G 7: 55,075,026 I112V probably damaging Het
Mgl2 T C 11: 70,135,680 S105P probably damaging Het
Mocs1 T A 17: 49,449,115 M200K possibly damaging Het
Oat T A 7: 132,567,198 I98L probably benign Het
Obscn T C 11: 59,029,486 Y8C Het
Olfr1462 G A 19: 13,191,404 V246I possibly damaging Het
Olfr786 T G 10: 129,437,450 F213V probably benign Het
Pde1b T A 15: 103,521,655 M137K possibly damaging Het
Phf21a T C 2: 92,327,139 I204T probably damaging Het
Plcd4 A G 1: 74,554,679 E321G possibly damaging Het
Plpp7 C T 2: 32,095,650 probably benign Het
Prdm1 A G 10: 44,441,570 I419T probably benign Het
Sec16b A T 1: 157,564,462 R855W probably damaging Het
Sec16b G T 1: 157,564,463 R855M probably damaging Het
Sec31b T C 19: 44,523,043 T640A probably benign Het
Siglec1 T C 2: 131,081,551 T425A possibly damaging Het
Skil T C 3: 31,097,175 probably benign Het
Slc1a5 G A 7: 16,785,698 V200M probably damaging Het
Slc25a12 T C 2: 71,324,025 H139R probably benign Het
Slc25a32 A T 15: 39,098,235 V187D probably damaging Het
Slc35a3 G A 3: 116,711,806 probably benign Het
Smap2 C A 4: 120,972,067 M328I probably benign Het
Spef2 C T 15: 9,599,980 probably null Het
Srarp A G 4: 141,433,078 V148A possibly damaging Het
Stard9 T A 2: 120,634,274 Y73* probably null Het
Tars A G 15: 11,392,019 C236R probably benign Het
Tchh G C 3: 93,444,530 D426H unknown Het
Tnks2 T C 19: 36,859,145 F17S Het
Ube2g1 T C 11: 72,663,113 I30T possibly damaging Het
Ube2o C T 11: 116,543,935 D567N possibly damaging Het
Unc5b A T 10: 60,772,223 Y710* probably null Het
Vmn1r215 T C 13: 23,075,919 V43A possibly damaging Het
Xkr8 A G 4: 132,728,337 F242L probably benign Het
Zfp526 T A 7: 25,225,920 C535S probably damaging Het
Other mutations in Afg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Afg1l APN 10 42339911 missense possibly damaging 0.86
IGL02041:Afg1l APN 10 42454380 missense probably damaging 0.98
IGL02309:Afg1l APN 10 42454378 missense possibly damaging 0.90
IGL02323:Afg1l APN 10 42454510 nonsense probably null
IGL03088:Afg1l APN 10 42426497 missense probably damaging 1.00
PIT4458001:Afg1l UTSW 10 42454370 nonsense probably null
R0969:Afg1l UTSW 10 42318621 missense probably damaging 1.00
R1665:Afg1l UTSW 10 42426577 missense probably damaging 1.00
R1703:Afg1l UTSW 10 42400399 missense probably damaging 1.00
R1766:Afg1l UTSW 10 42454495 missense probably benign 0.00
R2941:Afg1l UTSW 10 42478295 splice site probably null
R4846:Afg1l UTSW 10 42454494 missense probably benign 0.02
R4887:Afg1l UTSW 10 42454378 missense probably benign 0.00
R5668:Afg1l UTSW 10 42360240 missense probably damaging 1.00
R5934:Afg1l UTSW 10 42318686 missense probably damaging 1.00
R6575:Afg1l UTSW 10 42318716 missense probably damaging 1.00
R6972:Afg1l UTSW 10 42478374 missense probably benign 0.00
R7271:Afg1l UTSW 10 42415548 critical splice donor site probably null
R7577:Afg1l UTSW 10 42318611 missense probably damaging 1.00
R8458:Afg1l UTSW 10 42426521 missense probably damaging 0.98
Z1176:Afg1l UTSW 10 42478353 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGCTTGTGAAACTCTAAACAAGAC -3'
(R):5'- CCTTCCAGTAATCGAATTGGAATG -3'

Sequencing Primer
(F):5'- AAATATGCCACTCTGGGCTG -3'
(R):5'- TGATTAAACTCCATTGCATGTGG -3'
Posted On2019-06-26