Incidental Mutation 'R0583:Kcns3'
ID56524
Institutional Source Beutler Lab
Gene Symbol Kcns3
Ensembl Gene ENSMUSG00000043673
Gene Namepotassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
SynonymsD12Ertd137e
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R0583 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location11090202-11151056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 11091478 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 407 (N407H)
Ref Sequence ENSEMBL: ENSMUSP00000152026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055673] [ENSMUST00000164495] [ENSMUST00000217974]
Predicted Effect probably damaging
Transcript: ENSMUST00000055673
AA Change: N407H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060706
Gene: ENSMUSG00000043673
AA Change: N407H

DomainStartEndE-ValueType
BTB 15 124 1.2e-12 SMART
low complexity region 144 162 N/A INTRINSIC
Pfam:Ion_trans 184 417 5.2e-47 PFAM
Pfam:Ion_trans_2 325 411 3.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164495
AA Change: N407H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129412
Gene: ENSMUSG00000043673
AA Change: N407H

DomainStartEndE-ValueType
BTB 15 124 1.2e-12 SMART
low complexity region 144 162 N/A INTRINSIC
Pfam:Ion_trans 184 417 5.2e-47 PFAM
Pfam:Ion_trans_2 325 411 3.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217974
AA Change: N407H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Kcns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Kcns3 APN 12 11092426 missense probably benign 0.40
IGL01089:Kcns3 APN 12 11091571 missense possibly damaging 0.92
IGL01448:Kcns3 APN 12 11091643 missense possibly damaging 0.91
IGL02084:Kcns3 APN 12 11092194 missense probably damaging 0.96
IGL02229:Kcns3 APN 12 11092092 missense probably damaging 1.00
IGL02730:Kcns3 APN 12 11092075 missense probably benign
IGL02820:Kcns3 APN 12 11091871 missense probably benign 0.01
IGL03390:Kcns3 APN 12 11091232 missense probably benign
PIT4696001:Kcns3 UTSW 12 11092748 start gained probably benign
R0629:Kcns3 UTSW 12 11092558 missense probably damaging 1.00
R1549:Kcns3 UTSW 12 11092083 missense probably damaging 1.00
R1571:Kcns3 UTSW 12 11091550 missense probably damaging 1.00
R1755:Kcns3 UTSW 12 11091444 missense probably benign 0.09
R2507:Kcns3 UTSW 12 11092086 missense possibly damaging 0.67
R4348:Kcns3 UTSW 12 11091381 missense possibly damaging 0.85
R4667:Kcns3 UTSW 12 11091783 missense probably damaging 1.00
R4750:Kcns3 UTSW 12 11091654 missense probably damaging 1.00
R5704:Kcns3 UTSW 12 11092327 missense probably benign 0.05
R5770:Kcns3 UTSW 12 11092249 missense probably benign 0.15
R6882:Kcns3 UTSW 12 11092048 missense probably benign 0.00
R7014:Kcns3 UTSW 12 11091687 missense probably damaging 1.00
R8025:Kcns3 UTSW 12 11091845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCACGATGCCAATGGAAGAC -3'
(R):5'- AGTTACCATGAGGTGGGGCTACTG -3'

Sequencing Primer
(F):5'- TGCCAATGGAAGACAGACTG -3'
(R):5'- GAAAGATGAACACAAGTCCAGTCTC -3'
Posted On2013-07-11